/p0001.djvu

			Joanna Stryczyńska-Kazubska 


Barbara Zwoździak 


Katedra Profilaktyki Zdrowotnej 
Uniwersytetu Medycznego 
im. Karola Marcinkowskiego w Poznaniu 


Katedra i Zakład Mikrobiologii Lekarskiej 
Uniwersytetu Medycznego 
im. Karola Marcinkowskiego w Poznaniu 


OBRAZ KLINICZNY ORAZ OCENA WYBRANYCH 
CYTOKIN W ZAKAŻENIACH 
CHLAMYDOPHlLA PNEUMONIAE U DZIECI 


ROZPRAWA DOKTORSKA 


Promotorzy 


Prof. dr hab. med. 
Jacek Wysocki 


Prof. dr hab. med. 
Andrzej Szkaradkiewicz 


Poznań 2010
		

/p0002.djvu

			Składamy serdeczne podziękowania promotorom pracy 
Panom 


Prof. dr hab. med. Andrzejowi Szkaradkiewiczowi 
Kierownikowi Katedry i Zakładu Mikrobiologii Lekarskiej 
Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu 


Prof. dr hab. med. Jackowi Wysockiemu 
J .M. Rektorowi 
Kierownikowi Katedry Profilaktyki Zdrowotnej 
Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu 


za opiekę i nieocenioną pomoc, bez której praca ta nie powstałaby 


2
		

/p0003.djvu

			Panu Prof. dr hab. med. Lechowi Torlińskiemu 
Kierownikowi Katedry Chemii i Biochemii Klinicznej 
oraz Zakładu Biochemii Klinicznej 
Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu 


serdeczne podziękowania za umożliwienie przeprowadzenia badań i okazaną pomoc 
w interpretacji wyników 


Pani mgr anal. med. Alicji Brożek 
z Katedry Chemii i Biochemii Klinicznej 
Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu 


serdecznie dziękuję 
za pomoc w przeprowadzeniu badań 


Panu dr n. med. Tomaszowi Karpińskiemu 
z Katedry i Zakładu Mikrobiologii Lekarskiej 
Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu 


serdecznie dziękuję 
za pomoc w przeprowadzeniu badań mikrobiologicznych 


Pani dr n. med. Teresie Tułeckiej 
i Pani dr n. med. Izabeli Chudzickiej-Strugała 
z Katedry i Zakładu Mikrobiologii Lekarskiej 
Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu 


serdecznie dziękuję 
za okazaną życzliwość i wszechstronną pomoc 


3
		

/p0004.djvu

			Pani dr Grażynie Urbańskiej 
Ordynator Oddziału Dzieci Starszych I 


Pani dr Urszuli Lulewicz 
Ordynator Oddziału Dzieci Młodszych 


oraz 


Koleżankom 


z Oddziału Obserwacyjno Zakażnego, 
Oddziału Dzieci Starszych I 
i Oddziału Dzieci Młodszych 
Specjalistycznego Zespołu Opieki Zdrowotnej nad Matką i Dzieckiem w Poznaniu 


pragniemy podziękować 


za życzliwość i wsparcie w trakcie realizacji tej pracy 


4
		

/p0005.djvu

			SPIS TREŚCI 
1. WSTĘP ..................................................................................................................... 9 
1.1. Charakterystyka i przynależność taksonomiczna Chlamydophila pneumoniae . 9 
1.2. Cykl rozwojowy, budowa genomu, budowa antygenowa Chlamydophila 
pneumoniae....................................................................................................... 11 
1.2.1. Cykl rozwojowy Chlamydophila pneumoniae .......................................... 11 
1.2.2. Budowa genomu Chlamydophila pneumoniae.......................................... 14 
1.2.3. Budowa antygenowa Chlamydophila pneumoniae ................................... 15 
1.3. Aspekty kliniczne zakażeń układu oddechowego u dzieci............................... 15 
1.3.1. Cechy budowy dróg oddechowych małych dzieci.................................... 16 
1.3.2. Podział zakażeń dróg oddechowych z uwzględnieniem lokalizacji.......... 16 
1.3.3. Etiologia zakażeń układu oddechowego.................................................... 17 
1.4. Charakterystyka zakażenia Chlamydophila pneumoniae ................................. 18 
1.4.1. Epidemiologia zakażeń Chlamydophila pneumoniae................................ 18 
1.4.2. Przebieg zakażeń Chlamydophila pneumoniae ......................................... 21 
1.5. Diagnostyka Chlamydophila pneumoniae ........................................................ 30 
1.6. Immunopatologia.............................................................................................. 31 
1.6.1. Charakterystyka badanych cytokin............................................................ 32 
1.7. Chlamydophila pneumoniae a zaburzenia gospodarki lipidowej .....................34 
1.7.1. Charakterystyka badanych wykładników gospodarki lipidowej ............... 35 
1.8. Leczenie zakażeń Chlamydophila pneumoniae ................................................36 
2. CELE PRACy........................................................................................................ 39 
3 . MATERIAŁ I METODyKA.................................................................................. 40 
3.1. Pacjenci............................................................................................................. 40 
3.1.1. Grupa badana............................................................................................. 40 
3.1.2. Grupa kontrolna......................................................................................... 40 
3.2. Schemat badania............................................................................................... 41 
3.2.1. Badanie podmiotowe................................................................................. 42 
3.2.2. Badanie przedmiotowe.............................................................................. 42 
3.2.3. Analiza przebiegu klinicznego.................................................................. 42 
3.2.4. Badania dodatkowe.................................................................................... 43 
3.3. Analiza statystyczna......................................................................................... 53 
3.3.1. Metodyka opracowania statystycznego w zakresie analizy struktury 
badanej populacji i obrazu klinicznego .....................................................53 
3.3.2. Analiza statystyczna wyników badań mikrobiologicznych, 
immunologicznych i wykładników gospodarki lipidowej......................... 53 
4. WYNIKI I I C H O MÓWIENIE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 57 
4.1. Epidemiologia zakażeń Chlamydophila pneumoniae....................................... 57 
4.1.1. Częstość występowania zakażenia Chlamydophila pneumoniae .............. 57 
4.1.2. Częstość występowania zakażenia Chlamydophila pneumoniae w 
zależności od wieku................................................................................... 58 
4.1.3. Częstość występowania zakażenia Chlamydophila pneumoniae w 
zależności od płci....................................................................................... 61 
4.1.4. Wpływ chorób przewlekłych na częstość zakażeń Chlamydophila 
pneumoniae................................................................................................ 61 


5
		

/p0006.djvu

			4.1.5. Wpływ przewlekłego leczenia wziewnymi lekami kortykosteroidowymi 64 
4.1.6. Częstość zakażeń Chlamydophila pneumoniae w zależności od pory roku 
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 64 
4.1.7. Zależność częstości zakażeń Chlamydophila pneumoniae od przebywania 
w placówkach dla dzieci............................................................................ 66 
4.2. Przebieg kliniczny zakażenia Chlamydophila pneumoniae .............................66 
4.2.1. Postać choroby........................................................................................... 66 
4.2.2. Gorączka.................................................................................................... 68 
4.2.3. Czas trwania infekcji przed hospitalizacją ................................................ 68 
4.2.4. Zmiany osłuchowe oraz duszność............................................................. 69 
4.2.5. Zapalenie zatok.......................................................................................... 69 
4.2.6. Zapalenie ucha środkowego...................................................................... 70 
4.2.7. Zmiany radiologiczne................................................................................ 70 
4.2.8. Badania laboratoryjne................................................................................ 71 
4.2.9. Objawy spoza układu oddechowego . ........................................................ 72 
4.3. Leczenie............................................................................................................ 74 
4.3.1. Leczenie celowane w trakcie hospitalizacji............................................... 74 
4.3.2. Leczenie celowane po okresie hospitalizacji............................................. 75 
4.4. Badanie kontrolne............................................................................................. 76 
4.4.1. Oznaczenie Chlamydophila pneumoniae w wymazie z gardła ................. 76 
4.4.2. Związek pomiędzy leczeniem celowanym a eliminacją Chlamydophila 
pneumoniae z dróg oddechowych............................................................. 76 
4.4.3. Analiza przebiegu choroby dziecka z dodatnim wynikiem kontrolnym ... 78 
4.5. Analiza mikrobiologiczna, immunologiczna oraz ocena wykładników 
gospodarki lipidowej........................................................................................ 79 
4.5.1. Ocena występowania DNA Chlamydophila pneumoniae .........................79 
4.5.2. Ocena poziomu cytokin: IFN-y, IL-1
, TNF-a i IL-10 .............................80 
4.5.3. Wyniki oznaczeń wykładników gospodarki lipidowej.............................. 90 
5. D Y S KU SJ A ............................................................................................................ 92 
6 . WNIO S KI ............................................................................................................. 111 
7. STRESZCZENIE.................................................................................................. 112 
8 . SUMMARY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 115 
9. PIŚMIENNICTWO.............................................................................................. 118 


6
		

/p0007.djvu

			OBJAŚNIENIA SKRÓTÓW 


a.o. - astma oskrzelowa 
bp - base pair (pary zasad) 
CAP - Community-Acquired Pneumonia (pozaszpitalne zapalenie płuc) 
CRP - cysteine rich protein s (białka bogate w cysteinę) 
CRP - C-reactive protein (białko C-reaktywne) 
d.d.o. - dolne drogi oddechowe 
ElA - Enzyme Immunoassay (test immunoenzymatyczny) 
EB - elementary body (ciałko elementarne) 
ELISA - Enzyme Linked Immunosorbent Assay (test immunoenzymatyczny) 
GAG - glycosaminoglycan (glikozaminoglikan) 
g.d.o. - górne drogi oddechowe 
GLXA - antygen glikolipidowy 
grupa Z - grupa dzieci z zakażeniem Chlamydophila pneumoniae 
grupa NZ - grupa dzieci bez zakażenia Chlamydophila pneumoniae 
HDL - high density lipoprotein (lipoproteiny o wysokiej gęstości) 
IFN -y - interferon gamma 
IN - ciałko wtrętowe (inkluzja) 
IgA - immunoglobulina klasy A 
IgM - immunoglobulina klasy M 
IgG - immunoglobulina klasy G 
IL-1 
 - interleukina 1 
 
IL-10 - interleukina 10 
KDO - kwas 3-dezoksy-D-manno-2-oktulozowy 
LDL - low density lipoprotein (lipoproteiny o niskiej gęstości) 
LPL - lipaza lipoproteinowa 
LPS - lipopolisacharyd 
MIC - minimaI inhibitory concentration (minimalne stężenie hamujące) 
MIF - microimmunofluorescence assay (test mikroskopowy pośredniej fluorescencji) 
MOMP - major outer membrane protein s (główne białka błony zewnętrznej) 
NS - brak istotności statystycznej 
OUN - ośrodkowy układ nerwowy 
PCR - Polymaerase Chain Reaction (łańcuchowa reakcja polimerazy) 
PMP - polymorphic membrane protein s (białka polimorficzne błony) 


7
		

/p0008.djvu

			podgrupa L - podgrupa dzieci leczonych antybiotykiem makrolidowym w grupie Z 
podgrupa NL - podgrupa dzieci nieleczonych antybiotykiem makrolidowym w grupie Z 
RB - reticulate body (ciałko siateczkowate) 
SM - sclerosis multiplex (stwardnienie rozsiane) 
TG - triglicerydy (trój glicerydy, triacyloglicerole) 
T3S - Type 3 Secretion Apparatus (aparat sekrecyjny typu 3) 
TNF-a - Tumor Necrosis Factor a (czynnik martwicy nowotworu a) 
z.p. - zapalenie płuc 
z.u.ś. - zapalenie ucha środkowego 


8
		

/p0009.djvu

			1. WSTĘP 


Chlamydophila pneumoniae, należy do tzw. patogenów atypowych, które 
dawniej uważano za mikroorganizmy o niewielkim znaczeniu klinicznym. Jednak dane 
zebrane w ostatnich 20 latach sugerują istotny udział C. pneumoniae w zakażeniach 
układu oddechowego we wszystkich grupach wiekowych ludzi. Patogen ten pierwotnie 
uznawany za przyczynę ostrych zakażeń, obecnie zasługuje na uwagę również jako 
czynnik etiologiczny infekcji przewlekłych oraz powikłań, będących skutkiem nie tylko 
zakażeń ostrych, lecz także tych o przebiegu bezobjawowym [8,75, 90, 139]. 
W 1990 roku uznano, głównie na podstawie badań serologicznych, ze 
C. pneumoniae ma istotny udział w zakażeniach dróg oddechowych, szerzących się 
drogą kropelkową [178]. Patogen ten związany jest z występowaniem na świecie 6-20% 
pozaszpitalnych zapaleń płuc (CAP - Community-Acquired Pneumonia) u dzieci 
i dorosłych [10, 75]. Ponadto przypuszcza się, że może odgrywać rolę w powstawaniu 
zmian aterogennych [18, 69, 71]. Ten atypowy drobnoustrój wykazuje tropizm przede 
wszystkim do komórek nabłonka oddechowego, również m.in. do monocytów, 
makrofagów, komórek śródbłonka naczyń krwionośnych, a Jego występowanie 
opisywano w blaszkach miażdżycowych [55]. Ze względu na ważny udział 
C. pneumoniae w zakażeniach układu oddechowego o zróżnicowanym przebiegu 
i możliwość pojawienia się ich ciężkich następstw, zasadnym stała się, poza obserwacją 
kliniczną, analiza występowania tego czynnika etiologicznego u dzieci, ocena 
wybranych cytokin prozapalnych i przeciwzapalnych oraz zaburzeń gospodarki 
lipidowej, prawdopodobnie mających wpływ na przebieg procesu chorobowego i jego 
następstwa. 


1.1. Charakterystyka i przynależność taksonomiczna Chlamydophila 


. 
pneumonlae 
Chlamydophila pneumoniae to atypowy, obligatoryjnie wewnątrzkomórkowy, 
chorobotwórczy dla człowieka drobnoustrój, należący do rodziny Chlamydiaceae. 
Dawniej nazywany czynnikiem TW AR od skrótów zastosowanych dla oznaczenia 
dwóch pierwszych izolacji: TW-183 i AR-39. TW-183 (TW-Taiwan) - wyizolowany ze 
spojówki oka dziecka badanego na Tajwanie w 1965 roku, natomiast AR-39 (AR-Acute 
Respiratory) z materiału pobranego w przebiegu zapalenia gardła od studenta 
Uniwersytetu Washington w Seattle w 1983 roku [71]. W 1989 roku Chlamydia TW AR 


9
		

/p0010.djvu

			rozpoznano jako trzeci gatunek rodzaju Chlamydia i nazwano go Chlamydia 
pneumoniae [67]. W roku 1999 dokonano reklasyfikacji taksonomicznej (Ryc. 1), 
wyodrębniając rodzaj Chlamydophila i określając gatunek jako Chlamydophila 
pneumoniae [51]. Według obecnie stosowanej klasyfikacji chlamydii, do rodziny 
Chlamydiaceae należą drobnoustroje, których geny sekwencji 16S i 23S rRNA różnią 
się <10%, nie zawierają tRNA w przestrzeni międzygenowej i nie mają kwasu 
muramidowego. Rodzaj Chlamydophila charakteryzuje się > 95% identycznością 
sekwencji genowych 16S i 23S rRNA. Przedstawiciele, należący do rodzaju, produkują 
w zasadzie niewykrywalne ilości glikogenu, posiadają zróżnicowaną morfologię 
i różnią się opornością na tetracykliny, a wiele z nich posiada plazmidy [40, 80]. 
Gatunek Chlamydophila pneumoniae należy do linii "non-trachomatis", gromady: 
Chlamydiae, rzędu: Chlamydiales, rodziny: Chlamydiaceae i rodzaju: Chlamydophila 
[40, 51]. Na podstawie analizy sekwencji DNA Omp A, w obrębie gatunku 
Chlamydophila pneumoniae, wyróżniono patogenny dla człowieka biotyp TW AR 
[ 1 02] . 
Początkowe trudności w określeniu przynależności taksonomicznej chlamydii 
związane były z wykazywanymi przez nie cechami pośrednimi między wirusami 
i bakteriami. Cechą charakterystyczną jest wyróżniający je spośród innych bakterii 
unikatowy, wewnątrzkomórkowy cykl rozwojowy w komórkach nabłonka mięśni 
gładkich oraz monocytach/makrofagach. Cykl ten polega na współistnieniu dwóch form 
morfologicznych - ciałka elementarnego EB (elementary body) oraz ciałka 
siateczkowatego RB (reticulate body) [20, 51]. Chlamydie rozmnażają się wewnątrz 
wakuoli komórek eukariotycznych (wtręty cytoplazmatyczne), ale nie są zdolne do 
wytwarzania wysokoenergetycznych produktów (ATP). W związku z tym wymogi 
energetyczne bakterii zależne są od zapasów ATP komórki gospodarza tzw. 
pasożytnictwo energetyczne [6, 117]. Ponadto, nIe są one zdolne do biosyntezy 
nukleotydów de novo i zależą od zasobów nukleotydowych gospodarza [10]. 
Wspomniane cechy oraz niewielkie rozmiary (0,2 - 1,3 flm) zbliżają chlamydie do 
wirusów. Do cech odróżniających należą: podobna do bakterii Gram-ujemnych budowa 
ściany komórkowej [14], obecność dwóch kwasów nukleinowych (DNA i RNA) 
i niektórych organelli komórkowych, a także wrażliwość na wybrane antybiotyki [57, 
180] . 


10
		

/p0011.djvu

			Ryc. 1. Nowy podział taksonomiczny chlamydii (Everett i wsp. 1999) [51]. 


/I 


, 
II.. 
- ,. 
l. 
--- ---
 
CIJIaJ 
--. ..łI_ r 
J 

, 

 


- 
. c.. lIborlus 
C. psittBcI 
c. ,... 
C. CSKa8 


c. peccwun 


CIIlBn
....... 


c. ptH!IUIJ1!JIrIa 
".,. 
c. ltrJChOmaIbJ 
C. suIs 
C. mutiIarum 


P8rHh1..,.".... 


R _ 


lYatltJlla« 
 


w_ 
$. 
 



..... 


1.2. Cykl rozwojowy, budowa genomu, budowa antygenowa 
Chlamydophila pneumoniae 


1.2.1. Cykl rozwojowy Chlamydophila pneumoniae 
Cykl rozwojowy chlamydii trwa od 48-72 godzin i dla wszystkich gatunków 
przebiega jednakowo, w kilku etapach [40, 97, 180]. Bakterie te są bezwzględnymi 
pasożytami wewnątrzkomórkowymi, namnażającymi się wyłącznie w żywych 
komórkach eukariotycznych. Podczas cyklu rozwojowego współistnieją dwie formy 
morfologiczne. Ciałko podstawowe (EB - elementary body) jest postacią zakaźną, 
nieaktywną metabolicznie (stosunek RNA:DNA=l:l), natomiast ciałko siateczkowate 
(RB - reticular body) stanowi reprodukcyjną (stosunek RNA:DNA=3:1) postać 
wewnątrzkomórkową [20]. EB o średniej wielkości 0,2-0,35 flm otoczone jest błoną 
cytoplazmatyczną i grubą, sztywną ścianą komórkową, zbliżoną do bakterii Gram- 
, 
ujemnych. Sciana komórkowa nie zawiera w przestrzeni periplazmatycznej typowego 
peptydoglikanu. Jej warstwa zewnętrzna posiada główne białka błony zewnętrznej 
MOMP (major out er membrane proteins) oraz wiele białek bogatych w cysteinę CRP 
(cysteine rich proteins), które dzięki obecności mostków dwusiarczkowych, zapewniają 


11
		

/p0012.djvu

			ścianie komórkowej sztywność i odpowiadają za odporność na stres mechaniczny 
i osmotyczny [68, 76]. Sugeruje się istnienie, zarówno na powierzchni EB jak i komórki 
gospodarza, siarczanu glikozaminoglikanu (GAG - sulphated glycosaminoglycan), 
pośredniczącego w przyleganiu EB do komórki docelowej [27]. 
Formę wewnątrzkomórkową, reprodukcyjną, niezakaźną, aktywną metabolicznie, 
zdolną do syntezy białek, stanowi ciałko siateczkowate (RB). RB o średniej wielkości 
0,5-1,3 flm posiada cienką błonę komórkową o dużej przepuszczalności oraz 
zwiększoną liczbę rybosomów [6]. 
Cykl rozwojowy Chlamydophila pneumoniae rozpoczyna się wniknięciem EB do 
komórki gospodarza, na drodze endocytozy. Ciałko elementarne (EB) charakteryzuje 
kształt gruszkowaty i wielkość około 0,38 flm [40, 160]. Podczas wnikania EB, jedynie 
komórka gospodarza zużywa energię. Po około 6-8 godzin od zakażenia dochodzi do 
transformacji EB do RB. Różnicowanie to wiąże się z modyfikacją struktury białek 
błony zewnętrznej, wskutek redukcji mostków dwusiarczkowych, dekondensacją 
chromosomu, zwiększeniem rozmiaru (0,51 flm) i liczby rybosomów oraz zmIaną 
stosunku RNA do DNA z 1:1 na 3:1. Po około 20 godzinach cyklu, dochodzi do 
powstania ciałka wtrętowego (inkluzji - IN), zawierającego RB, które ulegają 
podziałom, przekształcając się w ciałka elementarne. Proces ten związany jest ze 
zmniejszeniem rozmiaru, kondensacją nukleoidu oraz utworzeniem sztywnej ściany 
komórkowej. Pod koniec cyklu rozwojowego wtręt cytoplazmatyczny osiągać może % 
objętości komórki gospodarza, zawierając nawet do 1000 nowych, dojrzałych, 
zakaźnych EB. Do ich uwolnienia dochodzi na skutek lizy, śmierci komórki oraz 
egzocytozy. 
Poza opisanym schematem cyklu replikacyjnego, reprezentującym ostre zakażenie 
chlamydialne, C. pneumoniae może przejść w stan niezakaźnej formy przetrwałej 
wewnątrz komórki gospodarza, Ryc. 2 [97]. Ponadto zakażenie to może utrzymywać się 
w organizmie przez długi czas, na co wpływ mają m.in. mechanizmy obronne 
uruchamiane przez gospodarza, które choć ograniczają szerzenie się zakażenia, nie są 
zdolne do jego całkowitej eliminacji. Formy przetrwałe chlamydii mogą powstać 
w wyniku opóźnienia dojrzewania RB lub różnicowania RB wEB. 
Patogeneza C. pneumoniae jest procesem złożonym, zależnym od zakażanej 
populacji komórek, zapoczątkowania stanu replikacyjnego lub niereplikacyjnego 
patogenu oraz efektywności uwalniania cząsteczek efektorowych do komórki 
gospodarza. Klucz do zrozumienia patobiologii przewlekłych zakażeń chlamydialnych 


12
		

/p0013.djvu

			tkwi w procesach genetycznych przetrwałego stanu oporności na leczenie. Przetrwałe 
C. pneumoniae posiadają atypową morfologię ultrastrukturalną z wtrętami, które 
prezentują jedynie kilka powiększonych ciałek albo zmienione struktury oraz odmienne 
profile ekspresji genów np. dla białek błony zewnętrznej OmpA i OmpB lub białek 
błony wtrętu [97]. Badania Byrne i wsp. wykazały, że przetrwałe formy C. pneumoniae 
wykazują wzmożoną ekspresję genów niezbędnych w replikacji DNA, ale nie dotyczy 
to genów zasadniczych dla podziału komórkowego [19]. C. pneumoniae może wnikać 
do różnorodnych komórek (np. komórek śródbłonka i komórek mięśni gładkich, 
komórek nabłonkowych pęcherzyków płucnych, komórek jednojądrzastych, limfocytów 
T, ale także komórek glejowych), co skutkuje wzmożoną ekspresją chomokin i cytokin 
zapalnych [21, 97]. 
Przetrwałe C. pneumoniae są zwykle oporne na antybiotykoterapię [63] i związane 
z przewlekłymi infekcjami, jak wykazano w zakażonym układzie naczyniowym. 
W odseparowanym od cytoplazmy mikrośrodowisku, wewnątrz wtrętu, C. pneumoniae 
tworzy niszę wewnątrzkomórkową. Z niszy tej stymuluje przeżycie lub śmierć komórki 
gospodarza, moduluje ścieżki sygnałów regulatorowych jego komórek oraz omija ich 
mechanizmy obronne. Tworzenie przetrwałych form chlamydii, w pewnych warunkach, 
może być indukowane m.in. antybiotykami zastosowanymi w leczeniu jako pierwsze 
[62] lub działaniem cytokin [97]. 


Ryc. 2. Cykl rozwojowy Chlamydophila pneumoniae wg [168]. 


13
		

/p0014.djvu

			1.2.2. Budowa genomu Chlamydophila pneumoniae 
Genom C. pneumoniae, opisany dla szczepu AR39 ocenia się na 1,229,853 bp 
(1130 genów) w elektroforezie PFGE (pulsedfield electrophoresis) i zawiera oba kwasy 
nukleinowe (DNA i RNA) [17, 50, 144]. Genom koduje około 1052 białek, z których 
ponad 200 jest charakterystycznych tylko dla C. pneumoniae, chociaż dotychczas nie 
poznano ich dokładnej funkcji. W badaniach Kalman i wsp. porównano genom 
C. pneumoniae i C. trachomatis sugerując istnienie regionu o większej zmienności 
genetycznej w pobliżu przypuszczalnego miejsca rozpoczęcia replikacji chromosomu 
chlamydialnego. Region zawiera geny, które kontrolują syntezę i wykorzystanie 
tryptofanu, biorącego udział w opóźnianiu cyklu rozwojowego chlamydii za 
pośrednictwem IFN -y oraz powstawaniu zakażeń przetrwałych. U C. pneumoniae 
stwierdzono obecność genów, kodujących białka (ADP/ATP translokazy), których 
zadaniem jest transport ATP z cytoplazmy komórki gospodarza. Po zsekwencjonowaniu 
w 1998 r. genomu, dowiedziono istnienia genów szlaku metabolicznego ATP [94]. 
Obecność i ekspresja tych genów sugeruje częściową zależność i pobór energii 
w postaci ATP z komórki gospodarza [153]. Pomimo sugestii o braku produkcji 
peptydoglikanu, wykazano i sklonowano prawie komplet genów kodujących szlak 
enzymów dla jego biosyntezy [25]. Prace badawcze wykazały również istnienie 21 
genów dla białek powierzchniowych, należących do nadrodziny PMP (polymorphic 
membrane proteins) oraz białek Inc (chlamydial inclusion membrane). Ich znaczenie, 
chociaż daje nadzieję na nowe determinanty odrębności gatunkowej, nadal pozostaje 
przedmiotem dyskusji [99]. 
Genom C. pneumoniae zawiera wszystkie niezbędne geny dla aparatu T3S (Type 3 
Secretion Apparatus). Molekularny aparat iniekcyjny wystaje z błony zewnętrznej 
i wydaje się funkcjonować zarówno w zakażeniu ostrym jak i przewlekłym [131], 
dlatego może stanowić istotny czynnik wirulencji. Wśród gatunków chlamydii istnieją 
różnice zależności od T3S, dotyczące niezbędnych do wkroczenia ścieżek sygnałów 
transdukcji. W przypadku C. pneumoniae stwierdzono A TP-azy dla aparatu T3S 
prawdopodobnie zaangażowane w działanie błony wewnętrznej patogenu [97]. Dla 
obligatoryjnie wewnątrzkomórkowych chlamydii, główną rolą funkcjonalnego T3S jest 
zapewnienie wzrostu i rozwoju, poprzez modyfikację sygnałów apoptozy i innych 
procesów transkrypcyjnych niezbędnych do ich przeżycia. Aparat T3S może mieć 
szczególne znaczenie w przetrwałych postaciach zakażenia C. pneumoniae z udziałem 
interferonu -y [97]. 


14
		

/p0015.djvu

			1.2.3. Budowa antygenowa Chlamydophila pneumoniae 
W obrębie rodzaju Chlamydophila wyróżnia się antygeny: swoiste grupowo 
(rodzajowo), swoiste gatunkowo, swoiste typowo (serotypowo). Antygen swoisty 
grupowo, wspólny dla wszystkich gatunków, jest zbudowany głównie z kompleksu 
wielocukrowolipidowego, w którym wyróżnia się dwie składowe: lipopolisacharydową 
(LPS) i glikolipidową (GLXA). LPS złożony jest z długołańcuchowych kwasów 
tłuszczowych, fosforanów, D-galaktozaminy, D-glikozaminy i kwasu 3-dezoksy-D- 
manno-2-oktulozowego (KDO). LPS jest obecny podczas całego cyklu rozwojowego na 
powierzchni zarówno ciałka elementarnego jak i siateczkowatego. W skład antygenu 
glikolipidowego (GLXA) wchodzi glukoza, mannoza, prawdopodobnie również 
galaktoza i dwa kwasy tłuszczowe. Występuje na powierzchni EB i RB, w obrębie błon 
komórkowych wtrętów cytoplazmatycznych, błon komórek gospodarza oraz 
w najbliższym otoczeniu zainfekowanych komórek, prawdopodobnie odgrywając 
istotną rolę w inicjowaniu zakażenia [172]. 
Antygeny swoiste gatunkowo umożliwiają ich różnicowanie i posiadają strukturę 
białkową. Najważniejszym jest białko MOMP, zbudowane z czterech hydrofilowych 
domen zmiennych i pięciu hydrofobowych domen stałych. N a podstawie analizy 
sekwencji DNA OmpA dla Chlamydophila pneumoniae wyróżniono patogenny dla 
człowieka biotyp TW AR [40, 51, 102]. 


1.3. Aspekty kliniczne zakażeń układu oddechowego u dzieci 
Choroby infekcyjne układu oddechowego należą do naj częstszych zakażeń 
występujących u dzieci. W Polsce brak dokładnych danych epidemiologicznych, 
zarówno co do częstości występowania samej infekcji, jak i poszczególnych czynników 
etiologicznych. Z badań McConnochie i wsp. wynika, iż na choroby dolnych dróg 
oddechowych zapada rocznie 23 na 100 dzieci w populacji do 2 lat, natomiast częstość 
zapaleń płuc u dzieci do 5 lat w Europie i Ameryce Północnej wynosi 34 do 40 
przypadków na 1000 dzieci na rok i wyłączając osoby powyżej 75 roku życia, jest 
w tym okresie życia najwyższa [111, 118]. 
Na częstość występowania zakażeń dróg oddechowych ma wpływ m.in. wiek dziecka, 
warunki socjalne, kontakt z rówieśnikami, palenie tytoniu czynne i bierne oraz 
wydolność układu immunologicznego i współwystępowanie niektórych chorób 
przewlekłych. Niedojrzałość mechanizmów obronnych u małych dzieci wpływa na 


15
		

/p0016.djvu

			częstsze infekcje w tym wieku, a cechy budowy dróg oddechowych, na ich przebieg 
kliniczny [100]. 
1.3.1. Cechy budowy dróg oddechowych małych dzieci 
O odmiennej budowie dróg oddechowych u małych dzieci stanowią między 
innymi [23]: 
- wąskie przewody nosowe 
- słabo rozwinięte zatoki przynosowe 
- krótka i szeroka trąbka słuchowa 
- tkanka limfatyczna - obfita w okolicy tchawicy i oskrzeli oraz gardła w okresie 
wczesnego dzieciństwa, z wyjątkiem okresu noworodkowego 
- mała, wąska i wiotka nagłośnia, wiotkie, zwłaszcza u niemowląt, pozostałe 
chrząstki krtani 
- krótkie drogi oddechowe 
- światło oskrzeli stosunkowo szerokie w stosunku do masy dziecka, jednak 
bezwzględna szerokość mała, co przy obrzęku śluzówki i wydzielinie w 
drogach oddechowych szybko doprowadza do znacznego zmniejszenia lub 
całkowitego zniesienia drożności 
- obfite ukrwienie błony śluzowej 
- intensywny rozwój mięśniówki gładkiej oskrzeli od ok. 4 m.ż 


1.3.2. Podział zakażeń dróg oddechowych z uwzględnieniem lokalizacji 
Ze względu na lokalizację zakażenie dróg oddechowych dzieli się na [22]: 
· infekcje górnych dróg oddechowych (g.d.o.), które obejmują: 
- Jamę nosową 
- jamę ustną 
- gardło 
- zatoki przynosowe 
- ucho środkowe 
· infekcje dolnych dróg oddechowych (d.d.o.), obejmujące: 
- krtań 
- tchawicę 
- oskrzela 
- oskrzeliki 
- płuca 


16
		

/p0017.djvu

			1.3.3. Etiologia zakażeń układu oddechowego 
Zakażenie układu oddechowego może być wywołane przez wIrusy, bakterie, 
grzyby oraz pasożyty. Ostre stany zapalne W układzie oddechowym najczęściej są 
wynikiem infekcji wirusowych, wśród których główną rolę odgrywają: rinowirusy, 
adenowirusy, koronawirusy, wirusy grypy i paragrypy, enterowirusy oraz Respiratory 
syncytial virus (RSV). Etiologia bakteryjna jest również zróżnicowana. Do grupy 
najczęściej odpowiedzialnych za pozaszpitalne zakażenia należą: Streptococcus 
pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Streptococcus pyogenes 
oraz bakterie określane jako atypowe: Chlamydophila pneumoniae, Mycoplasma 
pneumoniae, Legionella pneumophila [81]. W codziennej praktyce klinicznej, zgodnie 
z rekomendacjami postępowania w pozaszpitalnych zakażeniech układu oddechowego, 
diagnostykę mikrobiologiczną podejmuje się rzadko [81]. Nie zaleca się rutynowego 
wykonywania posiewu krwi, posiewu plwociny, wymazu z nosogardła ani badań 


serologicznych u dzieci leczonych ambulatoryjnie (z wyj ątkiem badań 
potwierdzaj ących paciorkowcowe zapalenie gardła oraz badania wycieku z ucha 
środkowego ). W badaniu obejmującym dzieci w wieku 2-24 mIesIęcy, leczone 


ambulatoryjnie z powodu zapalenia płuc, dodatni wynik posiewu krwi uzyskano jedynie 
u 1,6% chorych [155]. Według danych British Thoracic Society brak potwierdzenia 
czynnika etiologicznego u pacjentów z pozaszpitalnym zapaleniem płuc dotyczy 20- 
60% przypadków, etiologię mieszaną potwierdza się u 8-40% dzieci, u 14-35% 
stwierdza się zakażenie wirusowe, głównie u dzieci młodszych [28]. 
Wobec powyższych danych niezmiernie istotna jest znajomość odchyleń w badaniu 
przedmiotowym i badaniach dodatkowych oraz danych z badania podmiotowego, które 
ułatwiają różnicowanie etiologii bakteryjnej od wirusowej. Stosowania antybiotyków 
zgodnie z rekomendacjami, zarówno w zakresie wyboru odpowiedniego preparatu jak 
i zaleconej dawki, oraz nienadużywanie tych leków, jest ważną zasadą postępowania 


w 


zakażeniach 


układu 


oddechowego, 


zwłaszcza 


wobec 


narastającą 


antybiotykooporności [81]. Diagnostykę zmierzaj ącą do ustalenia czynnika 
etiologicznego podejmuje się najczęściej u pacjentów hospitalizowanych. Wśród 
zalecanych badań wymienia się posiew krwi, plwociny, badania serologiczne, testy 
umożliwiające wykrycie antygenów wirusowych, zwłaszcza RSV [81]. Należy również 
zaznaczyć, iż zastosowanie metod biologii molekularnej łącznie z oznaczaniem 
swoistych przeciwciał w diagnostyce zakażenia C.pneumoniae zwiększa czułość 
diagnostyki, zwłaszcza u chorych niemowląt i małych dzieci, u których, jak pokazują 


17
		

/p0018.djvu

			liczne badania, nie dochodzi do wytworzenia odpowiedzi serologicznej na zakażenie 
tym patogenem [4,48,71, 124, 135]. 


1.3.3.1. Rola bakterii atypowych w zakażeniach układu oddechowego 
Pojęcie "atypowe zakażenia układu oddechowego" po raz pierwszy zostało użyte 
w roku 1938. Określenie to, wprowadzone przez Reimana, dotyczyło zakażeń 
niereagujących na stosowane wówczas typowe leczenie penicyliną i sulfonamidami, 
zakażenie o przebiegu odmiennym od bakteryjnych zapaleń płuc: z nieznacznie 
podwyższoną lub prawidłową temperaturą ciała, z niewielkimi zmianami w badaniu 
przedmiotowym i rozległymi zmianami radiologicznymi. Nie ustalono wówczas 
czynnika etiologicznego zakażeń o atypowym przebiegu [30]. 
Obecnie do bakterii atypowych, powodujących zakażenia w układzie oddechowym 
zalicza się [23, 88]: 
- Mycoplasma pneumoniae 
- Chlamydophila pneumoniae 
- Legionella pneumophila 
- Coxiella burnetii 
Współcześnie coraz częściej podkreśla SIę fakt, iż zakażenie drobnoustrojami 
atypowymi nie łączy się z charakterystycznym przebiegiem klinicznym infekcji, 
obrazem w badaniu przedmiotowym ani zmianami radiologicznymi [4,96, 158]. 


1.4. Charakterystyka zakażenia Chlamydophila pneumoniae 
1.4.1. Epidemiologia zakażeń Chlamydophila pneumoniae 
Dane dotyczące epidemiologii zakażeń C. pneumoniae nIe są jednoznaczne 
i wydaje się, iż w znacznym stopniu zależą od zastosowanych metod diagnostycznych. 
Opierając się na badaniach serologicznych wykazano, że zakażenia układu 
oddechowego wywołane tym patogenem występują głównie u dzieci w wieku szkolnym 
i młodzieży, rzadziej u małych dzieci [78]. Poszerzenie diagnostyki o metody 
bezpośrednie, takie jak PCR, hodowla komórkowa, immunofluorescencja bezpośrednia, 
dostarczyło dowodów, iż zakażenia C. pneumoniae są powszechne również u małych 
dzieci i wg badania Michelowa i wsp. oraz Normanna blisko połowa zakażeń 
bakteriami atypowymi dotyczy dzieci poniżej 5 lat [113, 123]. 
Brak korelacji pomiędzy wynikami badań z wykorzystaniem metod bezpośrednich - 
łańcuchowej reakcji polimerazy (PCR) oraz immunofluorescencji pośredniej i metod 


18
		

/p0019.djvu

			serologicznych u małych dzieci dowodzi, że ww. dane oparte na badaniu przeciwciał są 
prawdopodobnie zaniżone, ponieważ małe dzieci nie wytwarzają odpowiedniego, 
uznanego za dodatnie, stężenia przeciwciał. Korelacja wyników uzyskanych w obu 
metodach wzrasta wraz z wiekiem. 


Analizując prewalencję zakażeń C. pneumoniae, oprócz metod laboratoryjnych 
wykorzystanych do potwierdzenia zakażenia, nie bez znaczenia wydaje się również 
rodzaj pobranego materiału. Większość badań metodą PCR dotyczy wymazów z tylnej 
ściany gardła. Badanie antygenów C. pneumoniae w tkankach migdałków gardłowych 
dzieci w wieku od 1 do 15 lat, poddanych adenotomii ze wskazań klinicznych, 
potwierdziło zakażenie u 98,5% pacjentów, spośród których tylko w 7% otrzymano 
wynik dodatni w wymazie z gardła oraz u 20% serologiczne dowody przebytego 
zakażenia przy użyciu metody mikroimmunofluorescencji (MIF). Dodatni wynik 
przeciwciał uzyskano u dzieci powyżej 5 lat, natomiast wśród młodszych, mimo 34 
dzieci z potwierdzoną obecnością bakterii w tkankach migdałka, w żadnym przypadku 
wynik badań serologicznych nie potwierdził ani przewlekłego, ani przebytego 
zakażenia [124]. Podobne badanie przeprowadzone zostało w Polsce. Wśród dzieci 
poddanych adenotomii u 58% potwierdzono obecność C. pneumoniae w tkankach 
migdałka gardłowego, ale wyniki te nie korelowały z uzyskanymi z wymazów z gardła 
i tylko u 10% z serologicznym potwierdzeniem przebytego zakażenia (IgG w teście 
MIF) [26]. Dane te wskazują na częstsze zakażenia tym patogenem w populacji 
dziecięcej, niż wynika to zarówno z badań serologicznych jak i wymazów z gardła 
metodą PCR. Migdałki, element układu limfatycznego i jednocześnie oddechowego, są 
prawdopodobnie rezerwuarem patogenu, podobnie jak monocyty i makrofagi. Na 
podstawie tych danych nie można jednak stwierdzić jak często po pierwotnym 
zakażeniu C. pneumoniae pozostaje w komórkach układu limfatycznego. 
Analiza udziału C. pneumoniae jako czynnika etiologicznego ostrych zakażeń 
dróg oddechowych tylko przy użyciu metod bezpośrednich również dostarcza 
niejednoznacznych wyników. Od 3,1 % wśród pacjentów z objawami grypopodobnymi 
wieku 0-16 lat w Holandii (462 badanych), 14% wśród dzieci japońskich (411 badanych 
z objawami ostrej infekcji dróg oddechowych) do 45% w badaniach Falcka i wsp. [53, 
85]. 


Analiza badań serologicznych, na podstawie dodatnich przeciwciał w klasie IgG 
jako potwierdzenia przebytej infekcji C. pneumoniae, wykazuje korelację pomiędzy 


odsetkiem 


. 
 
pacJentow 


z 


wynikiem 


dodatnim 


a 


wiekiem. 


Na podstawie 


19
		

/p0020.djvu

			przeprowadzonych badań epidemiologicznych uwaza SIę, iż ponad 50% ludności 
w świecie przeszło zakażenie C. pneumoniae. Dodatni wynik przeciwciał w klasie IgG 
stwierdzono u kilku procent dzieci przedszkolnych, 23%-70% dzieci szkolnych 
i u ponad 80% osób starszych. Częściej dochodzi do zakażeń w krajach o klimacie 
ciepłym. Nie ma jednoznacznych wyników dotyczących związku pomiędzy porą roku 
i zwiększeniem ilości zakażeń C.pneumoniae [34,44, 151, 169]. 
W populacji dorosłych przebyte zakażenie częściej potwierdzane jest 
u mężczyzn niż u kobiet. Nie stwierdzono istotnych różnic statystycznych w częstości 
zakażenia w zależności od płci wśród dzieci [102, 123]. 
Nie wykazano związku pomiędzy częstością zakażeń (dodatni wynik przeciwciał 
w klasie IgG) a biernym paleniem tytoniu, ilością rodzeństwa, warunkami socjalnymi. 
W badaniu Normanna nie wykazano również związku z chorobami alergicznymi, astmą 
oskrzelową oraz długością karmienia piersią [124, 169]. 
C. pneumoniae może być czynnikiem odpowiedzialnym za epidemie w szkołach, 
przedszkolach, domach opieki społecznej czy w koszarach, powodując zachorowania 
o różnej symptomatologii klinicznej oraz zwiększone nosicielstwo [45,72, 122, 167]. 
Pierwotne zakażenie nie daje długotrwałej odporności. Szacuje się, iż większość 
osób ulega w ciągu życia kilkakrotnemu zakażeniu C. pneumoniae. Kolejne zakażenia 
mają jednak łagodniejszy przebieg kliniczny [45, 98]. 


1.4.1.1. Nosicielstwo Chlamydophila pneumoniae 
Nosicielstwo C. pneumoniae w drogach oddechowych osób zdrowych, bez 
nawracających infekcji w wywiadzie wykazano u 1,5-6% badanych [47, 48, 53, 84, 
151]. Układ oddechowy nie jest jednak jedynym miejscem bytowania C. pneumoniae. 
Analizując nosicielstwo należy również wziąć pod uwagę odsetek osób bez objawów 
choroby, u których bakterie C. pneumoniae wykryto w monocytach krwi obwodowej. 
W większości badań potwierdzono nosicielstwo bakterii w monocytach u ok. 40%, 
natomiast istnieją również dane potwierdzające nosicielstwo w komórkach krwi 
obwodowej dziesięciokrotnie rzadziej (4,3% w badaniu Sassa) [13, 149, 154]. 


1.4.1.2. Drogi szerzenia się zakażenia Chlamydophila pneumoniae 
Najczęściej do zakażenia dochodzi drogą kropelkową przez przenIesIenIe 
patogenu z wydzieliną z dróg oddechowych zakażonej osoby. C. pneumoniae nie 
charakteryzuje SIę wysoką zakaźnością. Infekcyjność cząsteczek aerozolu 


20
		

/p0021.djvu

			w temperaturze pokojowej zmniejsza się o połowę w trakcie 30 sekund. Potwierdzono 
możliwość przetrwania zdolnej do zakażania postaci C. pneumoniae na powierzchniach 
np. blaty pokryte laminatem plastikowym (Formica countertops) do 30 godzin oraz np. 
na papierowych chusteczkach do 12 godzin, sugerując możliwość przeniesienia 
zakażenia również tą drogą. Okres wylęgania wynosi kilka tygodni (po ok. 3 tygodniach 
obserwowano kolejne zachorowania w środowiskach domowych) [54, 102]. 
1.4.2. Przebieg zakażeń Chlamydophila pneumoniae 
C. pneumoniae jest czynnikiem etiologicznym zapaleń przede wszystkim 
w obrębie dróg oddechowych. Infekcja ta może dotyczyć zarówno górnego jak 
i dolnego odcinka. Ten wewnątrzkomórkowy patogen ma powinowactwo do komórek 
nabłonka dróg oddechowych. Zakażenie może przebiegać bezobjawowo, dawać objawy 
ostrego zapalenia, może również mieć przebieg przewlekły lub nawrotowy. Wśród 
naj częstszych rozpoznań, łączonych z zakażeniem C. pneumoniae, wymienia SIę 
zapalenie płuc (z.p.), oskrzeli, gardła, zapalenie ucha środkowego (z.u.ś.), zatok, ale 
również rzadziej występujące podgłośniowe zapalenie krtani. Wśród stanów 
przewlekłych zakażenie C. pneumoniae łączone jest z astmą oskrzelową oraz 
przerostem migdałków. Prawdopodobnie C. pneumoniae mo ze być czynnikiem 
etiologicznym schorzeń spoza układu oddechowego tj. zmian miażdżycowych naczyń 
tętniczych, chorób ośrodkowego układu nerwowego, stawów, mięśnia sercowego 
i osierdzia, a także wywoływać rumień guzowaty [85, 102, 123, 159, 173]. 
Wobec niskiej czułości metod diagnostycznych opartych na wykrywaniu 
przeciwciał u dzieci i wysokich kosztów metod bezpośrednich, uwzględniając szerokie 
występowanie C. pneumoniae u pacjentów z infekcją dróg oddechowych w każdym 
wieku, istotną wydaje się analiza cech klinicznych zakażeń tym patogenem i odpowiedź 
na pytanie, czy mogą one stanowić wskazówkę do podjęcia odpowiedniego leczenia. 
Badanie Normanna i wsp. (360 dzieci) wykazało, iż pacjenci z ostrym stanem zapalnym 
zarówno w obrębie górnych jak i dolnych dróg oddechowych, z potwierdzonym 
zakażeniem C. pneumoniae, chorowali dłużej w porównaniu z pacjentami z ujemnym 
wynikiem (średni czas utrzymywania się objawów 21 dni vs 14), rzadziej wymagali 
hospitalizacji, a choroba miała łagodniejszy przebieg. Nie stwierdzono natomiast 
istotnych różnic co do stężenia białka C-reaktywnego w surowicach krwi w obu 
grupach [123]. 


21
		

/p0022.djvu

			Mimo ustąpienia objawów ostrej infekcji C. pneumoniae może pozostać w komórkach 
nabłonka układu oddechowego lub w krwinkach białych (limfocyty, monocyty, 
makrofagi). Przetrwałe w drogach oddechowych zakażenie może klinicznie objawiać 
się nawracającymi zapaleniami, ale bierze się także pod uwagę udział C. pneumoniae 
w etiologii astmy oskrzelowej. W badaniu Esposito nosicielstwo w gardle w grupie 
dzieci z nawracającymi infekcjami stwierdzono u 13,5%, w porównaniu z dziećmi 
niechorującymi nawrotowo, gdzie patogen potwierdzono u 1,5% badanych [48]. 
W badaniach na zwierzętach (myszy) wykazano, że po wprowadzeniu C. pneumoniae 
do układu oddechowego dochodzi do przedostania się patogenu wewnątrz makrofagów 
do układu naczyniowego i dalej tą drogą do kolejnych narządów, m.in. śledziony 
i otrzewnej. W modelu zwierzęcym potwierdzenie obecności C. pneumoniae 
w makrofagach w narządach pozapłucnych stwierdzano z taką samą częstotliwością jak 
w tkance płucnej. Wykrycie C. pneumoniae w monocytach ludzkich pozwala 
przypuszczać, że zakażenie u ludzi przebiega podobnie do opracowanego modelu 
zwierzęcego. Drogą krwionośną może dojść do przeniesienia bakterii do licznych 
narządów. Nie ma jednak danych jak długo utrzymuje się zakażenie monocytów u ludzi 
i u jakiego odsetka osób z zakażeniem układu oddechowego dochodzi do przedostania 
się patogenu do krwiobiegu. Z opisanych wcześniej badań tkanek, usuniętych z powodu 
przerostu, migdałków gardłowych wynika, że narządy układu limfatycznego mogą być 
miejscem przewlekłego zakażenia C. pneumoniae. Również badania nad zmianami 
miażdżycowymi w naczyniach potwierdzają przewlekłą postać zakażenia. Wśród 
zdrowych pacjentów w wieku 40-64 lat (średnia wieku 49 lat), którzy stanowili grupę 
kontrolną w badaniu Bomana i wsp. wykazano C. pneumoniae w monocytach krwi 
obwodowej, będących rezerwuarem patogenu u 46%, natomiast w badaniu fińskim 
obejmującym populację zdrowych mężczyzn (średnia wieku 45 lat) serologiczne 
potwierdzenie przewlekłego zakażenia (dodatnie przeciwciała w klasie IgA i IgG) 
u 20% badanych, przy czym ich odsetek wzrastał z wiekiem [13, 107]. 


1.4.2.1. Manifestacje kliniczne zakażenia Chlamydophila pneumonaie w drogach 
oddechowych 


1.4.2.1.1. Górne drogi oddechowe 
Objawy stanu zapalnego górnych dróg oddechowych należą do częściej 
pojawiających SIę w przebiegu zakażenia C. pneumoniae. Potwierdzenie zakażenia 


22
		

/p0023.djvu

			c. pneUmOnlae u dzieci z ostrym stanem zapalnym górnych dróg oddechowych 
uzyskuje się u 10-58% badanych [53]. Jedynie dane holenderskie pochodzące z badania 
Tjhie i wsp. są niższe i kształtują się na poziomie 3% [166]. W badaniu Esposito nad 
etiologią ostrego zapalenia gardła, które nie ograniczało się jedynie do potwierdzenia 
zakażenia C. pneumoniae, lecz obejmowało równIez identyfikację innych bakterii, 
potwierdzono występowanie tego patogenu u 13% dzieci, jednak tylko w 3% 
przypadków był to jedyny wykrywalny patogen. U większości dzieci z potwierdzonym 
zakażeniem C. pneumoniae w tym badaniu uzyskano ustąpienie objawów bez 
stosowania antybiotykoterapii skutecznej w stosunku do C. pneumoniae [47]. 
Na uwagę zasługuje również problem objawów przewlekłego zakażenia g.d.o. 
pod postacią przerostu migdałka gardłowego. Badania tkanek migdałka uzyskanych 
podczas adenotomii, wykonanej z powodu przerostu, wykazało występowanie 
C. pneumoniae u wysokiego odsetka dzieci - w badaniach polskich 58%, natomiast 
w badaniach Normana i wsp. aż u 98,5% dzieci. Ponieważ wyniki te nie korelowały 
z serologicznym potwierdzeniem zakażenia, a także ze względu na fakt, że nie ma 
możliwości badania tkanek migdałków u dzieci, u których po ostrej infekcji 
C. pneumoniae nie obserwuje się ich przerostu, nie można ocenić, jak często zakażenie 
to prowadzi do przewlekłej obecności patogenu w układzie limfatycznym. 
Przekroczenie bariery śluzówkowej dróg oddechowych oraz migracja C. pneumoniae 
wewnątrz komórek monocytarnych, może prowadzić do zmian narządowych, w tym 
również przerostu migdałków [26, 124]. 


1.4.2.1.2. Dolne drogi oddechowe 
Zapalenie oskrzeli oraz zapalenie płuc to naj częstsze postacie kliniczne zakażenia 
C. pneumoniae w obrębie d.d.o. [73, 102, 173]. Częstość zakażeń C. pneumoniae 
u pacjentów ze stanem zapalnym d.d.o. wymieniana w literaturze, podobnie jak 
w przypadku pozostałych schorzeń o tej etiologii, przede wszystkim zależy od metod 
diagnostycznych zastosowanych przez badacza. Zapalenie płuc wywołane przez 
bakterie atypowe do niedawna łączono z charakterystycznym obrazem klinicznym: 
podostry początek, niewysoka gorączka, śluzowa, skąpa wydzielina z dróg 
oddechowych, niewielkie zmIany osłuchowe przy rozległych zmianach 
radiologicznych. Na podstawie badań serologicznych uznano, iż typowy wiek dla 
chlamydiowego zapalenia płuc to 5-15 lat [4, 112]. 


23
		

/p0024.djvu

			Obecnie pojawia się coraz więcej doniesień pokazujących, iż większość infekcji 
d.d.o. wywołanych przez C. pneumoniae, w tym również zapaleń płuc, przebiega 
klinicznie podobnie jak infekcje o innej etiologii. Również wyniki badań dodatkowych - 
laboratoryjnych i radiologicznych, nie odbiegają od uzyskiwanych w przypadku zapaleń 
płuc i oskrzeli o innej etiologii. Wyniki badań odczynów zapalnych takich jak białko 
C-reaktywne, czy prokalcytonina są podobne jak w infekcjach wirusowych. 
W porównaniu z zapaleniami płuc wywołanymi przez Streptococcus pneumoniae, przy 
zakażeniu C. pneumoniae przebieg często bywa łagodniejszy. W przypadku z.p., 
podobnie jak w infekcjach g.d.o niejednokrotnie stwierdza się koinfekcję innymi 
patogenami tj. Streptococcus pneumoniae oraz Mycoplasma pneumoniae [46, 96, 113, 
152]. 
W badaniach wykorzystujących bezpośrednie metody diagnostyczne 
C. pneumoniae wymieniany jest jako czynnik odpowiedzialny za pozaszpitalne 
zapalenia płuc w 7- 14%. Badania te potwierdzają udział C. pneumoniae jako czynnika 
etiologicznego również wśród małych dzieci - w badaniu Michelowa i wsp. średnia 
wieku dzieci z potwierdzonym zakażeniem wynosiła 35 miesięcy, a blisko 50% dzieci 
z potwierdzonym zakażeniem patogenem atypowym ( C. pneumonlae lub 
M. pneumoniae) miała poniżej 5 lat [113]. 
C. pneumoniae jest często wykrywanym patogenem u dzieci z niepoddającą się 
leczeniu infekcją d.d.o. (z.o., z.p.). W badaniu Schmidta, obejmującym 428 dzieci, na 
podstawie badania wydzieliny oskrzelowej pobranej w trakcie bronchoskopii, 
z wykorzystaniem metody PCR, C. pneumoniae stwierdzono u 33% chorych. 
Zastosowanie celowanej antybiotykoterapii poprawiało funkcję układu oddechowego. 
W części przypadków potwierdzono koinfekcję S. pneumoniae oraz M. pneumoniae 
[152]. Wśród objawów klinicznych współwystępujących przy zapaleniu płuc o etiologii 
C. pneumoniae wymienia się świszczący oddech oraz nieżyt nosa. 


1.4.2.1.3. Astma oskrzelowa 
Wpływ C. pneumoniae na częstość występowania oraz przebieg astmy 
oskrzelowej (a.o.) jest przedmiotem licznych badań. Zdolność tej wewnątrzkomórkowej 
bakterii do przewlekłego zakażenia, wytwarzania białka szoku termicznego (Hsp 60), 
a w konsekwencji do nasilenia odpowiedzi zapalnej gospodarza oraz niszczenia 
śluzówki układu oddechowego może tłumaczyć, potwierdzony licznymi badaniami, 
związek pomiędzy zakażeniem C. pneumoniae a objawami astmy. Dokonując przeglądu 


24
		

/p0025.djvu

			badań z lat 1985-1999, obejmującego 18 kontrolowanych badań epidemiologicznych, 
Hahn potwierdził związek pomiędzy zakażeniem C. pneumoniae a astmą oskrzelową 
w 15 z nich. W części potwierdzono również wpływ przedłużonego leczenia 
antybiotykami skutecznymi wobec C. pneumoniae na poprawę lub całkowite ustąpienie 
objawów astmy. W 5 z 6 badań potwierdzono związek zakażenia C. pneumoniae 
z przewlekłą obturacyjną chorobą płuc [74]. 
Badania dotyczące wpływu ostrego zakażenia C. pneumonlae na zaostrzenie a.o. 
w populacji osób dorosłych wykazały związek pomiędzy zakażeniem a nasileniem 
objawów. Pacjenci z potwierdzonym zakażeniem uzyskiwali gorsze wskaźniki 
wydolności układu oddechowego w badaniu spirometrycznym [29, 33]. Nie 
zaobserwowano natomiast korelacji pomiędzy ciężkością a.o. a zakażeniem 
C. pneumoniae u dzieci. Częściej zakażenie potwierdzano u chorych z astmą 
nieatopową. Wyniki te korelują z uzyskanymi przez Normanna i wsp., które wykazały 
na podstawie długotrwałej (4-letniej) obserwacji dzieci z zakażeniem C. pneumoniae 
w wywiadzie, iż w grupie tej, w porównaniu z dziećmi, które nie przebyły zakażenia, 
rzadziej rozpoznawano choroby o podłożu atopowym (13,4% vs 4,7%) [79, 121, 163]. 
W przytoczonych powyżej badaniach wykazano współwystępowanie zarówno ostrego 
jak i przewlekłego zakażenia C. pneumoniae z a.o. Wiadomo, iż jednym z czynników 
prowadzących do zaostrzenia astmy są infekcje, a C. pneumoniae jest jednym 
z częstszych patogenów, mających powinowactwo do komórek nabłonka układu 
oddechowego. W ww. badaniach mało jest danych porównujących wpływ zakażeń 
wywołanych przez inne patogeny na częstość i nasilenie zaostrzeń astmy oskrzelowej 
oraz na jej występowanie. Porównania takiego dokonał Normann i wsp. w badaniach 
dotyczących przebiegu zakażeń C. pneumoniae nie potwierdzili oni, iż zaostrzenie 
astmy oskrzelowej oraz incydenty świszczącego oddechu u dzieci związane są ze 
specyficznym zakażeniem. Częstość występowania tych objawów z zakażeniem 
C. pneumoniae nie odbiegała istotnie od obserwowanej u pacjentów z zakażeniami 
wywołanymi przez Inne patogeny. Badania dotyczące związku zakażenia 
C. pneumoniae z astmą oskrzelową nie są jednak jednoznaczne. W niektórych z nich nie 
potwierdzono związku pomiędzy zakażeniem a nasileniem objawów astmy [114, 123]. 
Przegląd badań klinicznych i ich analiza w bazie Cochrane, uwzględniająca 
badania z randomizacją, w których oceniano wpływ czterotygodniowego leczenia 
makrolidami na przebieg astmy oskrzelowej nie wykazały wpływu tej terapii na 
natężoną objętość wydechową pierwszosekundową (FEVI) mimo, iż osiągnięto 


25
		

/p0026.djvu

			zmniejszenie ilości granulocytów kwasochłonnych w wydzielinie dróg oddechowych 


[141]. 


1.4.2.1.4. Zapalenie ucha środkowego 
Jednym z częstych objawów klinicznych obserwowanym u dzieci z zakażeniem 
układu oddechowego z potwierdzonym udziałem C. pneumoniae, jest zapalenie ucha 
środkowego. Mimo, iż w większości opisanych przypadków patogen ten izolowany był 
z wymazu z gardła, istnieją doniesienia o potwierdzeniu występowania C. pneumoniae 
w wysięku z ucha środkowego [12, 52, 128]. Częstość występowania ostrego z.u.ś. 
o etiologii C. pneumoniae jest w chwili obecnej trudna do ustalenia. W okresie 
zwiększonej ilości infekcji C. pneumoniae, w badaniach skandynawskich patogen ten 
został potwierdzony u 62% chorych z rozpoznanym zapaleniem ucha środkowego, 
w tym u 60% pacjentów, u których wykonano paracentezę, potwierdzono 
C. pneumoniae w pobranym materiale z ucha środkowego [52]. W innych badaniach 
patogen ten potwierdzono u znacznie mniejszego odsetka pacjentów z z.u.ś. (Block 
i wsp. u 8%, Ogawa i wsp. u 14%). Istnieją również doniesienia o braku potwierdzenia 
metodą PCR obecności C. pneumoniae w wysięku ucha środkowego u pacjentów 
z wysiękowym zuś [64]. Wyniki badań, które nie ograniczały się jedynie do 
potwierdzenia występowania C. pneumoniae u pacjentów z z.u.ś., lecz obejmowały 
szeroką diagnostykę mikrobiologiczną mającą na celu ustalenie etiologii stanu 
zapalnego, wykazują, podobnie jak w przypadku zapalenia gardła, iż C. pneumoniae 
w przypadku zuś rzadko jest jedynym wykrywanym patogenem. W śród najczęściej 
wymienianych ko-patogenów znajdują się: Haemophilus influenzae, Streptococcus 
pneumoniae, Moraxella catarrhalis. [12, 52, 128]. 


1.4.2.1.5. Układ sercowo-naczyniowy i gospodarka lipidowa 
Zgodnie z obecnym stanem wiedzy, miażdżycę naczyń uważa się za chorobę 
pierwotnie zapalną. Szereg badań dowodzi, że podwyższone markery zapalne takie jak 
CRP, fibrynogen, interleukina 6 i 2 (IL-6, IL-2) są wskaźnikami ryzyka sercowo- 
naczyniowego. W ostatnim czasie poszukuje się również związku pomiędzy 
powstawaniem zmian miażdżycowych w naczyniach, a czynnikami infekcyjnymi. Teza 
o związku zakażenie C. pneumoniae z patologią naczyń po raz pierwszy została 
postawiona w 1992 roku przez Shora i współpracowników, którzy wykryli bakterie 
w blaszkach miażdżycowych zmienionych tętnic wieńcowych [156]. 


26
		

/p0027.djvu

			Analiza zmIan morfologicznych ścian naczyń dotkniętych miażdżycą wykazała 
obecność zróżnicowanych morfologicznie form C. pneumoniae (ciałka RB i EB) 


w 


cytoplazmie komórek mięśniowych 


, 
naczyn oraz 


w przestrzeniach 


międzykomórkowych. C. pneumoniae jako patogen wewnątrzkomórkowy, bytujący 
m.in. w monocytach i makrofagach dostaje się do ściany naczyń z komórkami 
gromadzącymi się w miejscu stanu zapalnego i prowadzi do uszkodzenia śródbłonka, 
mając zdolność dalszej stymulacji makrofagów do wydzielania czynników zapalnych 
[110, 174]. Mimo szeregu badań potwierdzających obecność C. pneumoniae 
w zmienionych miażdżycowo naczyniach oraz wysokiego odsetka pacjentów 
z dodatnim poziomem przeciwciał, świadczącym o przewlekłym zakażeniu (IgA i IgG), 
jego rola w tworzeniu zmian miażdżycowych nadal nie jest jasna. Nie znaleziono 
odpowiedzi na pytanie, czy C. pneumoniae może zapoczątkować proces tworzenia się 
zmian miażdżycowych, czy dostając się w miejsce obecnych już zmian z monocytami, 
tylko nasila zapoczątkowany już wcześniej lokalny proces zapalny. Istnieją również 
badania kwestionujące związek pomiędzy zakażeniem a nasileniem zmIan 
miażdżycowych w naczyniach. Przeprowadzona przez Danesha i wsp., opublikowana 
w 1997 roku w The Lancet, metaanaliza badań nad związkiem pomiędzy różnymi 
czynnikami infekcyjnymi a procesem miażdżycowym w naczyniach wieńcowych, 
objęła 18 badań dotyczących udziału C. pneumoniae w tworzeniu się zmian 
w naczyniach. Na podstawie analizy przeprowadzonych badań, wykazano, iż związek 
ten jest możliwy jednak nie udowodniony [38]. Dalsze badania tego zagadnienia 
w większości potwierdzają związek pomiędzy przewlekłym zakażeniem a zmianami 
w naczyniach. Kato i wsp. analizowali u pacjentów hemodializowanych zależność 
zmian w naczyniach, na podstawie obserwacji tętnicy szyjnej, od wybranych 
czynników. Jednym z nich było zakażenie C. pneumoniae. Wykazali w trakcie 4-letniej 
obserwacji, iż u pacjentów z przewlekłym zakażeniem C. pneumoniae (dodatnie 
przeciwciała w klasie IgA), nasilenie zmian w naczyniach było większe w porównaniu 
z pacjentami z ujemnym IgA. Nie wykazano zależności nasilenia zmian od obecności 
przeciwciał IgG przeciw C. pneumoniae. Wysunięto wniosek, iż zakażenie 
C. pneumoniae może przyczyniać się do pogłębienia patologii naczyń, zwłaszcza 
wtedy, gdy proces ten został już wcześniej zapoczątkowany [95]. Większość badań, 
dotyczących obecności C. pneumoniae w naczyniach tętniczych, potwierdza 
występowanie patogenu w blaszkach miażdżycowych od kilkunastu nawet do 100% 
badanych pacjentów ze zmianami naczyniowymi oraz u 1-9% w ścianach naczyń 


27
		

/p0028.djvu

			pacjentów bez miażdżycy. Badania te dotyczą nIe tylko naczyń wieńcowych, ale 
również obejmują zmiany w aorcie, tętnicach szyjnych, tętnicach kończyn dolnych oraz 
nerkowych. 
Istnieją również badania, które nIe dowiodły istotnego udziału C. pneumonlae 
w procesach miażdżycowych. W badaniu Kwona i wsp., którzy zastosowali metodę 
PCR do badania czynników infekcyjnych w płytkach miażdżycowych u 128 
koreańskich pacjentów, oraz przeprowadzili porównanie z grupa kontrolną (20 
pacjentów), wykazano, iż najczęściej wykrywanym drobnoustrojem były enterowirusy 
(22/128- 17,1 %), natomiast C. pneumoniae występowały tylko u 1,6% chorych (2/128). 
W badaniu ścian naczyń grupy kontrolnej nie wykryto drobnoustrojów [36, 77, 101, 
103, 105]. Obecność C. pneumoniae w monocytach krwi obwodowej pacjentów 
poddawanych koronarografii z powodu choroby naczyń wieńcowych (103 badanych, 
średnia wieku 64 lata) wykryto u 59%, natomiast w grupie kontrolnej (średnia wieku 49 
lat) u 43% [13]. Badania dotyczące wpływu zakażenia C. pneumoniae na proces 
atherogenezy nie ograniczają się do potwierdzenia obecności patogenu w blaszkach 
miażdżycowych czy serologicznych dowodów na zakażenie u chorych pacjentów, lecz 
obejmują również analizą zależność profilu tłuszczów w surowicy i jego zależności od 
przewlekłego zakażenia C. pneumoniae. 
Projekt WHO - MONICA, obejmujący populacje zamieszkujące na terenach o wysokiej 
zapadalności na chorobę niedokrwienną serca, potwierdził związek pomiędzy 
zakażeniem, a niekorzystnym profilem lipidów (całkowity poziom cholesterolu oraz 
frakcji HDL) u mężczyzn. Wyniki te znalazły potwierdzenie w dalszych badaniach tego 
zagadnienia, również wśród pacjentów, u których zakażenie C. pneumoniae 
potwierdzone zostało metodami bezpośredniej detekcji (PCR) bakterii w zmienionych 
naczyniach. Nie wykazano natomiast istotnych statystycznie różnic w zakresie poziomu 
cholesterolu i jego frakcji u kobiet. Również badania wśród zdrowych dzieci, 
z dodatnimi przeciwciałami w klasie IgG lub IgA w trakcie 4-letniej obserwacji, nie 
wykazały wpływu infekcji na profil tłuszczów we krwi [77, 107, 119, 171]. 
Biorąc po uwagę wyniki wielu badań, wskazujących na udział C. pneumoniae 
w procesach miażdżycowych w naczyniach, analizowano wpływ antybiotykoterapii 
skierowanej przeciw C. pneumoniae w leczeniu pacjentów ze zmianami naczyniowymi. 
Większość badań, analizujących wpływ długotrwale stosowanego leczenia na 
zaawansowanIe zmIan miażdżycowych, nIe wykazała skuteczności takiego 
postępowania zarówno w stosunku do naczyń wieńcowych jak i obwodowych. Wyniki 


28
		

/p0029.djvu

			te potwierdziło badanie WIZARD (badanie z randomizacją oraz grupą otrzymującą 
placebo) obejmujące 7747 pacjentów z zawałem mięśnia sercowego w wywiadzie, 
w którym leczenie azytromycyna prowadzono przez 12 tygodni [22, 92, 126]. 


1.4.2.1.6. Układ nerwowy 
W szeregu badań potwierdzono hodowlą lub metodą PCR obecność 
C. pneumonlae w płynie mózgowo-rdzeniowym u pacjentów ze schorzeniami 
ośrodkowego układu nerwowego (OUN). Część badaczy łączy zwiększone 
występowanie tego patogenu ze stwardnieniem rozsianym (SM) oraz chorobą 
Alzheimera. W badaniu Siriam i wsp. potwierdzono przy użyciu hodowli zwiększoną 
częstość występowania patogenu (65%) u osób z rozpoznanym SM w porównaniu 
z grupą kontrolną (22%), którą stanowili pacjenci z innymi schorzeniami OUN. Dalsze 
badania poddają pod wątpliwość związek zakażenia C. pneumoniae z SM, ale 
potwierdzają częstsze występowanie bakterii u pacjentów z chorobami OUN 
w porównaniu z osobami zdrowymi. W większości badań, potwierdzenia w płynie 
mózgowo-rdzeniowym dokonywano za pomocą metody PCR. Nie wiadomo, czy 
przenoszona przez monocyty do OUN infekcja jest czynnikiem inicjującym proces 
zapalny (m.in u osób z predyspozycją genetyczną do SM), czy przewlekłe zakażenie 
jest czynnikiem stale stymulującym immunologiczną reakcję w OUN, a także czy jest to 
wtórna infekcja występująca częściej u pacjentów z patologią OUN w porównaniu 
z osobami zdrowymi. Potwierdzenie obecności C. pneumoniae w płynie mózgowo- 
rdzeniowym również u pacjentów, u których nie stwierdzono patogenu w monocytach 
krwi obwodowej, sugeruje, iż OUN jest miejscem infekcji C. pneumoniae nawet 
w sytuacji eliminacji patogenu z monocytów, a komórki tkanki nerwowej, obok 
nabłonka dróg oddechowych, monocytów, makrofagów i komórek mięśniówki gładkiej 
stanowią rezerwuar tego patogenu w organizmie [60, 61, 108, 157, 179]. 


1.4.2.1.7. Zapalenie stawów 
Potwierdzono występowanie C. pneumoniae - form aktywnych metabolicznie 
1 zdolnych do zakażania, w błonie maziowej oraz płynie stawowym pacjentów 
z reaktywnym zapaleniem stawów, potwierdzając w ten sposób udział bakterii 
w zmianach zapalnych narządu ruchu [59, 129]. 


29
		

/p0030.djvu

			1.5. Diagnostyka Chlamydophila pneumoniae 
Atypowy charakter Chlamydophila pneumoniae oraz groźba powikłań przebytych 
zakażeń stwarza konieczność rozwoju metod diagnostycznych, cechujących się prostotą 
i szybkością wykonania oraz wysoką czułością i swoistością. Wraz z postępem 
diagnostyki następuje rozwój badań nad składem antygenowym bakterii, przyczyniając 
się do lepszego poznania reaktywności immunologicznej gospodarza w procesie 
zakażenia. Zastosowanie metod diagnostycznych w badaniach epidemiologicznych 
może być również pomocne w ocenie grup ryzyka w przypadku rozwoju miażdżycy lub 
choroby niedokrwiennej serca [160]. 
Do metod diagnostycznych zakażeń C. pneumonlae należą: metody hodowlane 
(hodowla komórkowa), metody wykrywające antygen (metoda immunofluorescencji 
bezpośredniej), metody serologiczne (metoda immunoenzymatyczna), metody biologii 
molekularnej, wykrywające DNA C. pneumoniae (reakcja łańcuchowa polimerazy). 
Technikę hodowli komórkowej, chociaż powszechnie uważa się za tzw. gold 
standard, najbardziej swoistą metodę w diagnostyce zakażeń chlamydialnych, to jej 
czułość waha się w granicach 50-90% i wykonuje jedynie w ośrodkach referencyjnych. 
Do hodowli C. pneumoniae wykorzystywane są linie komórkowe, takie jak komórki 
raka szyjki macicy (HeLa-229) oraz HL i Hep-2. 
Postępem w wykrywaniu zakażeń chlamydialnych okazało się wprowadzenie 
w 1982 r. przez Stephensa i wsp. wysoce swoistych przeciwciał monoklonalnych. Po 
oznakowaniu przeciwciał izotiocyjanianem fluoresceiny znalazły zastosowanie 
w bezpośrednim teście immunofluorescencyjnym, celem wykrywania białek MOMP 
ciałek elementarnych C. pneumoniae. 
Metody serologiczne oparte są o wykrywanie swoistych przeciwciał klas - IgM, 
IgA i IgG. Do najczęściej stosowanych należą: test mikroskopowy pośredniej 
fluorescencji (MIF microimmunofluorescence assay) oraz techniki 
immunoenzymatyczne ElA (enzyme immunoassay). Przeciwciała przecIw 
C. pneumonlae rzadko wykrywane są w surowIcy dzieci, natomiast ich 
rozpowszechnienie wzrasta u młodzieży i młodych dorosłych. W przypadku dorosłych 
sporadycznie zdarzają się pierwotne ostre zakażenia, a obecność surowiczych 
przeciwciał jest wskaźnikiem reinfekcji lub infekcji przewlekłej [70, 160]. 
Nowe możliwości diagnostyczne w zakażeniach chlamydialnych stwarza rozwój 
metod biologii molekularnej (np. PCR - polymerase chain reaction), opartych na 


30
		

/p0031.djvu

			analizie kwasów nukleinowych. Badania te są niejednokrotnie szybsze, prostsze 
i przede wszystkim dokładniejsze, prowadząc do wyparcia dotychczas stosowanych 
technik. Wartość diagnostyczna polimerazowej reakcji łańcuchowej oceniana jest przez 
większość autorów wysoko, ze względu na czułość przewyższającą metodę hodowli, 
podczas gdy swoistość jest porównywalna. Ponadto niebywałą zaletą staje się 
możliwość badania kwasów nukleinowych ze znikomo niewielkich ilości materiału 
genetycznego [160, 180]. 


1.6. Immunopatologia 
Mechanizmy odpornościowe gospodarza, reakcje i czynniki immunologiczne, 
biorące udział w rozwoju ostrych i przewlekłych postaci zakażenia C. pneumoniae 
nadal podlegają badaniom. W przebiegu zakażenia uruchomione zostają mechanizmy 
odporności nieswoistej oraz swoistej, humoralnej i komórkowej. Podczas infekcji 
pierwotnej, gdy drobnoustroje namnażają się w komórkach docelowych początkowo 
zaangażowane są mechanizmy odporności nieswoistej , a następnie dochodzi do 
nacieczenia miejsca zakażenia fagocytami, głównie leukocytami wielojądrzastymi. 
W neutralizacji zakażenia pewne znaczenie odgrywa miejscowa produkcja sekrecyjnych 
przeciwciał, IgA. Lokalne wytwarzanie przeciwciał uważa się jedynie za ograniczenie 
szerzenia się zakażenia chlamydialnego, bez całkowitej eliminacji drobnoustrojów 
z organIzmu. 
Jako pierwsze zakażeniu ulegają komórki nabłonka, które po około 24 godzinach 
wydzielają cytokiny o działaniu prozapalnym. Cytokiny wykazują właściwości 
chemotaktyczne i aktywacyjne w stosunku do neutrofilów, monocytów i limfocytów T, 
a także stymulują wydzielanie cytokin prozapalnych przez makrofagi oraz białek ostrej 
fazy. 


W zakażeniu przewlekłym, podczas utrzymywania SIę mikroorganizmów 
w komórkach gospodarza lub reinfekcji, dochodzi do powstania miejscowego stanu 
zapalnego w znacznie krótszym okresie i ze zwiększonym nasileniem. 
W etiopatogenezie zakażeń chlamydialnych szczególną rolę przypisuje SIę 
interferonowi odpornościowemu (IFN-y), wydzielanemu przez limfocyty T. IFN-y ma 
wpływ na zahamowanie cyklu rozwojowego chlamydii. Wykazano, że jego wysokie 
stężenia hamują całkowicie rozwój bakterii, a średnie i niskie powodują powstawanie 
odmiennych od EB i RB, niezakaźnych form rozwojowych [43, 94, 180]. 


31
		

/p0032.djvu

			1.6.1. Charakterystyka badanych cytokin 
Cytokiny należą do cząsteczek regulujących proliferację i różnicowanie komórek 
w ustroju. Te hormonopodobne peptydy i niskocząsteczkowe białka pełnią rolę 
w patogenezie chorób o podłożu zapalnym [142]. Dzięki oddziaływaniu na wiele 
komórek są uważane za mediatory reakcji zapalnych i immunologicznych np. IL-1, 
TNF-a. Charakteryzują się cechami takimi jak plejotropia, czyli zdolność określonej 
cytokiny do oddziaływania na wiele różnych komórek i wywoływania zróżnicowanych 
efektów oraz redundacja, czyli właściwość różnych cytokin wywierania takiego samego 
efektu. 
Limfocyty T, w zależności od pobudzenia antygenem, mitogenem lub wirusem, 
mogą wytwarzać interferon y (IFN-y). IFN-y wywiera zróżnicowany wpływ na układ 
odpornościowy poprzez m.In. pobudzanie cytotoksyczności limfocytów T 
cytotoksycznych (CTL), komórek K, komórek NK, aktywację makrofagów, wzmaganie 
fagocytozy, działanie przeciwbakteryjne oraz przeciwwirusowe, a także indukcję 
ekspresji innych cytokin np. IL-1, TNFa. IFN-y odgrywa kluczową rolę jako jeden 
z naj silniej szych aktywatorów makrofagów, które nabywają właściwości 
cytotoksycznych, dzięki czemu skuteczniej niszczą fagocytowane drobnoustroje. 
Hamuje on również migrację makrofagów i pobudza je do wytwarzania reaktywnych 
związków tlenowych, wydzielania TNFa, IL-1 i innych cytokin. Na podstawie 
przeprowadzonych badań wykazano, że IFN -y zwiększa wytwarzanie nadtlenków 
w makrofagach i granulocytach obojętnochłonnych, a tym samym wzmaga ich zdolność 
do zabijania bakterii [142]. IFN-y we współdziałaniu z innymi cytokinami uczestniczy 
w różnicowaniu limfocytów B w kierunku komórek uwalniających przeciwciała. 
Jednakże wpływ ten jest niejednolity, bowiem w efekcie może stymulować produkcję 
przeciwciał jednych klas i hamować wytwarzanie immunoglobulin innych klas. 
Interleukina 1 stanowi jeden z głównych regulatorów odpowiedzi 
immunologicznej i zapalnej, oddziałując na prawie wszystkie typy komórek. Określana 
jest jako czynnik aktywujący limfocyty [41]. Wydzielana głównie przez monocyty 
i makrofagi z różnych tkanek. Do czynników indukujących jej uwolnienie należą m.in. 
lipopolisacharydy, bakterie, peptydoglikany, sama IL-1, czy TNF-a. Na transkrypcję 
i translację IL-1 wpływ mają inne cytokiny. Na jej wytwarzanie stymulująco wpływa 
TNF-a, a działanie supresyjne wykazuje IFN-y [54]. Oprócz monocytów i makrofagów 
innymi komórkami zdolnymi do wydzielania IL-1 mogą być komórki śródbłonka, 
limfocyty B oraz limfocyty T (w niewielkich ilościach). Istnieją dwa zasadnicze typy 


32
		

/p0033.djvu

			interleukiny 1: IL-1 ci i IL-1 a, które są produktami różnych genów. Monocyty 
stymulowane LPS wytwarzają głównie IL-1
. IL-1 ułatwia rozwój reakcji zapalnej 
przez chemotaksję neutrofilów i monocytów. Oddziałuje na śródbłonek, wzmagając 
m.in. jego przepuszczalność oraz przyleganie limfocytów neutrofilów do komórek 
śródbłonka. IL-1 wytwarzana przez komórki naczyń może aktywować mIeJscowo 
ekspresję wielu genów kodujących czynniki wzrostowe i inne cytokiny, a przez to 
zapoczątkować kaskadę miejscowych procesów zapalnych [41]. Właściwości IL-1 
mogą wskazywać na jej rolę w rozwoju miażdżycy i procesie neowaskularyzacji. 
Czynnik martwicy nowotworu a (TNF-a) należy do nadrodziny białek, które 
regulują proliferację, aktywację i różnicowanie wielu komórek, a także mogą 
indukować w nich śmierć przez apoptozę. To cytokina o właściwościach 
przeciwnowotworowych i immunomodulujących. Odgrywa również ważną rolę 
w zapaleniu i wstrząsie septycznym [142]. Prekursor TNF-a pojawia się na powierzchni 
komórki jako białko trans błonowe, a do środowiska uwolniony jest w wyniku działania 
proteaz. Aktywny biologicznie TNF-a występuje w postaci trimerów połączonych 
niekowalencyjnie. TNF-a wytwarzany jest przede wszystkim przez makrofagi 
i monocyty, ale także np. przez neutrofile. Najsilniejszym bodźcem do jego 
wytwarzania jest LPS ścian komórkowych bakterii. To właśnie one odpowiedzialne są 
za wzmożone wydzielanie TNF w zakażeniach bakteryjnych, co prowadzić może do 
niewydolności wielu narządów i śmierci, a w stanach przewlekłych do wyniszczenia. 
Wytwarzanie i uwalnianie TNFa stymulowane jest przez IFN-y, IL-1. Do inhibitorów 
jego produkcji należy np. IL-10. TNF-a to jedna z głównych cytokin odpowiedzi 
zapalnej i immunologicznej. Jest endogennym pirogenem wywołującym gorączkę przez 
bezpośredni wpływ na neurony podwzgórza i pośrednio poprzez indukcję wydzielania 
IL-1 również o działaniu gorączkotwórczym [142]. Działa chemotaktycznie na 
monocyty i neutrofile, aktywując je podobnie jak makrofagi. Aktywuje neutrofile 
zwiększając ich właściwości fagocytarne. Stymuluje wytwarzanie przez neutrofile 
reaktywnych związków tlenowych i wzmaga ich właściwości bakteriobójcze 
i cytotoksyczne. TNF-a wywiera nie tylko bezpośredni wpływ na układ odpornościowy, 
ale także indukuje uwalnianie wielu cytokin np. IFN -y z limfocytów, IL-1 
z makrofagów. Cytokina ta nasila adherencję neutrofilów do śródbłonka naczyń 
i stymuluje migrację tych komórek przez ścianę naczyń krwionośnych. Przypuszcza się 
również, że TNF-a odgrywa istotną rolę w patogenezie chorób o charakterze zapalnym 
w ośrodkowym układzie nerwowym, płucach, nerkach i innych narządach [89, 142]. 


33
		

/p0034.djvu

			TNF-a, wraz z innymi czynnikami np. IL-1, jest współodpowiedzialny za rozwój 
kacheksji (wyniszczenia) obserwowanej w niektórych chorobach zakaźnych. Osłabia on 
aktywność lipazy lipoproteinowej (LPL) w tkance tłuszczowej, hamując transkrypcję jej 
genu. TNF-a zmniejsza lipogenezę również przez hamowanie syntezy innych enzymów, 
biorących udział w syntezie tłuszczu np. syntetazy kwasów tłuszczowych 
i karboksylazy acetylo-CoA. Indukuje również lipolizę w adipocytach. TNF-a 
wywołuje więc zubożenie tkanki tłuszczowej w zapasy lipidów, sprzyjając rozwojowi 
kacheksji [89]. 
Interleukina 10 (IL-10) wydzielana jest przede wszystkim przez pobudzone 
limfocyty T, zwłaszcza Th2, ale także przez limfocyty B, monocyty, czy makrofagi. 
Pełni wiele funkcji, które prowadzą do hamowania odpowiedzi immunologicznej typu 
komórkowego i odpowiedzi zapalnej. Bierze udział m.in. w hamowaniu wytwarzania 
IFN-y przez limfocyty Th1 i Th2, w hamowaniu wytwarzania cytokin przez monocyty 
1 makrofagi (m.in. IL-1, TNF-a). IL-10 wywiera wyraźne działanie przeciwzapalne 
1 określana jest jako czynnik inaktywujący makrofagi. Stanowi induktor czynności 
limfocytów B oraz stymuluje ich proliferację i różnicowanie oraz sytnezę przeciwciał. 
IL-10 moduluje odpowiedź organizmu na działanie czynników infekcyjnych. 
Wytwarzana jest w zwiększonych ilościach podczas wstrząsu septycznego i może 
zmniejszać toksyczne działanie bakteryjnych lipopolisacharydów [109]. We wstrząsie 
może hamować wydzielanie IL-1 i TNF-a, a jej neutralizacja prowadzi do wzrostu 
produkcji tych cytokin [89, 142]. 


1.7. Chlamydophila pneumoniae a zaburzenia gospodarki lipidowej 
c. pneumoniae może wnikać do różnorodnych komórek (m.in. komórek 
śródbłonka i komórek mięśni gładkich, komórek nabłonkowych pęcherzyków płucnych, 
komórek jednojądrzastych). Początkowo, podczas zapalenia płuc mikroorganizmy 
pochłaniane są przez neutrofile, a przekazanie ich komórkom jednojądrzastym 
skutkować może ogólnoustrojowym rozsiewem. Komórki śródbłonka naczyń 
krwionośnych i mięśni gładkich są wysoce podatne na zakażenia tym patogenem, 
prowadząc do rozwoju fenotypów aterogennych i rozrostowych. Konsekwencją mogą 
być złożone zmiany w naczyniach krwionośnych np. dysfunkcja śródbłonka, destrukcja 
jego integralności, utrzymywanie blaszek miażdżycowych z dalszym ich przerwaniem. 
Trzy kluczowe elementy rozwoju miażdżycy stanowią: zapalenie, proliferacja ścian 


34
		

/p0035.djvu

			naczyń krwionośnych oraz dysfunkcja śródbłonka [97]. Etiopatogeneza miażdżycy jest 
procesem złożonym, zależnym od czynników zarówno zewnątrzustrojowych (np. 
otyłość) jak i wewnątrzustrojowych (np. wiek, płeć, uwarunkowania genetyczne). 
Bezpośrednią przyczynę stanowią jednak zaburzenia metabolizmu ściany naczyń 
krwionośnych oraz zaburzenia gospodarki lipidowej. Zakażenie i inwazja patogenów 
stymuluje komórki układu odpornościowego, zwiększając ekspresję cytokin, adhezję 
białek i uwalnianie czynników tkankowych, które przez kontakt z przepływającą krwią, 
aktywują proces krzepnięcia, m.in. na wytworzonych już wcześniej blaszkach 
miażdżycowych [7, 38, 125, 146]. 
Obecnie przypuszcza się, że C. pneumoniae odgrywa rolę w powstawaniu zmian 
aterogennych, a drobnoustrój może stanowić istotny czynnik ryzyka miażdżycy [10, 18, 
71]. W związku z tym zasadnym wydaje się analiza wykładników gospodarki lipidowej: 
cholesterolu całkowitego, jego frakcji HDL, LDL i triglicerydów w zakażeniach 
u dzieci. 


1.7.1. Charakterystyka badanych wykładników gospodarki lipidowej 
Związki lipidowe w organizmie człowieka pochodzą zarówno z pożywienia, jak 
1 syntezy własnej. Należą do nich: triglicerydy, cholesterol i fosfolipidy. 
Z triglicerydów, na skutek działania lipazy trzustkowej, powstają wolne kwasy 
tłuszczowe. Nienasycone kwasy tłuszczowe stanowią ważny element strukturalny błon 
komórkowych, jako składnik fosfolipidów. Biorą również udział w metabolizmie 
cholesterolu i zapobiegają miażdżycy naczyń. 
Lipidy powierzchniowe - fosfolipidy i cholesterol w postaci wolnej oraz 
rdzeniowe, jak triglicerydy i estry cholesterolu, wraz z kompleksami białek 
(apolipoproteiny) tworzą lipoproteiny. Lipoproteiny osocza podzielone zostały na kilka 
głównych grup, do których należą lipoproteiny o niskiej gęstości (LDL - low density 
lipoprotein) oraz lipoproteiny o wysokiej gęstości (HDL - high density lipoprotein). 
Zadaniem LDL jest dostarczanie cholesterolu komórkom w celu regeneracji. 
Cholesterol jest syntetyzowany w 80% zapotrzebowania w każdej komórce organizmu 
człowieka, z wyjątkiem mózgu. Przewaga małych, gęstych lipoprotein LDL wiąże się 
z podwyższonym stężeniem lipoprotein bogatych w triglicerydy oraz obniżonym 
stężeniem cholesterolu w HDL. Konfiguracja ta świadczy o obniżeniu transportu 
zwrotnego i sprzyja rozwojowi miażdżycy. Małe, gęste LDL dłużej przebywają 


35
		

/p0036.djvu

			w krążeniu i są bardziej podatne na modyfikację oksydacyjną, co potęguje ich 
proaterogenny charakter. 
Za transport zwrotny cholesterolu tzn. transport od komórek tkanek obwodowych 
do wątroby odpowiedzialne są lipoproteiny o wysokiej gęstości (HDL). W procesie tym 
następuje usuwanie nadmiaru lipidów od komórki obwodowej, a skończywszy na 
wydaleniu z organizmu. Lipoproteiny HDL charakteryzują się niską zawartością 
lipidów w stosunku do wysokiej zawartości białek [37]. 
Triglicerydy (trójglicerydy, triacyloglicerole, TG) są lipidami wytwarzanymi 
głównie w wątrobie, a w surowicy krwi występują głównie we frakcji chylomikronowej 
(triglicerydy egzogenne) oraz VLDL (triglicerydy endogenne). Wraz z wolnymi 
kwasami tłuszczowymi stanowią jeden z głównych materiałów energetycznych 
zużywanych na bieżące potrzeby organIzmu lub magazynowane w postaci tkanki 
tłuszczowej, jako materiał zapasowy [3]. 


1.8. Leczenie zakażeń Chlamydophila pneumoniae 
Chlamydophila pneumoniae, patogen obligatoryjnie wewnątrzkomórkowy, 
wrażliwy jest jedynie na wybrane grupy antybiotyków takie jak: makrolidy, 
tetracykliny, chinolony. Skuteczność wymienionych antybiotyków tłumaczy się ich 
bardzo dobrą penetracją do wnętrza komórki [4]. 
Z względu na szereg przeciwwskazań do stosowania tetracyklin i fluorochinolonów 
u dzieci, najczęściej stosowaną w praktyce grupą antybiotyków są makrolidy, do 
których należą: erytromycyna, spiramycyna, rowamycyna oraz antybiotyki tzw. nowej 
generacji: azytromycyna, roksytromycyna, klarytromycyna. 
Trudno jednoznacznie określić kryterium skuteczności antybiotykoterapii w stosunku 
do C. pneumoniae. Skuteczność należałoby rozpatrywać w odniesieniu do: 
- ustąpienia objawów infekcji dróg oddechowych, 
- eliminacji patogenu z dróg oddechowych, 
- eradykacji mikrobiologicznej, z uwzględnieniem komórek będących rezerwuarem 
C. pneumoniae tj. monocytów, komórek mięśni gładkich naczyń, komórek układu 
nerwowego 1 In. 
Badania u dzieci z klinicznymi i radiologicznymi objawami zapalenia płuc, 
porównujące skuteczność erytromycyny podawanej w standardowej dawce 40mg/kg/d 
przez 10 dni ze skutecznością klarytromycyny w dawce 15mg/kg/d stosowanej 10 dni, 


36
		

/p0037.djvu

			wykazały podobną skuteczność kliniczną obu leków (98% vs 95%), a eradykację 
c. pneumoniae z dróg oddechowych uzyskano odpowiednio u 79% i 86% chorych 
dzieci. Brak eliminacji C. pneumoniae z dróg oddechowych pozostałych pacjentów nie 
wiązał się z brakiem wrażliwości na antybiotyk oraz nie był związany z minimalnym 
stężeniem hamującym wzrost patogenu (MIC). W tym przypadku MIC go dla 
klarytromycyny i erytromycyny wynosił odpowiednio 0,031ug/m oraz 0,125 ug/ml i nie 
uległo ono zmianie po leczeniu. Dalsze badania nad skutecznością azytromycyny 
w populacji zarówno dorosłych jak i dzieci z pozaszpitalnym zapaleniem płuc wykazały 
podobną, wysoką skuteczność kliniczną, natomiast eradykację patogenu uzyskano 
u 70% dorosłych z potwierdzonym zakażeniem oraz u 83% dzieci. Warto dodać, iż 
w grupie kontrolnej czworo dzieci otrzymywało amoksycyklinę z kwasem 
klawulanowym i u wszystkich pacjentów z tej grupy również stwierdzono eliminację 
C. pneumoniae z nosogardła. Jest to jednak zbyt mała liczebnie grupa, aby wyciągać 
wnioski z ww. wyników co do skuteczności antybiotyku uznawanego za nieaktywny 
w stosunku do C. pneumoniae. W badaniu tym określono również MIC so i MIC go , które 
w przypadku azytromycyny wynosiły odpowiednio 0,125ug/ml oraz 0,5ug/ml i nie 
zmieniły się po leczeniu u pacjentów, u których nie uzyskano eradykacji. 
Nieskuteczność leczenia w odniesieniu do eliminacji C. pneumonlae z dróg 
oddechowych nie wiązała się więc z antybiotykoopornością [11, 143]. 
Obecnie uważa się, iż leczenia zapaleń płuc o etiologii C. pneumoniae należy 
prowadzić przez 2 tygodnie [31]. 
W przypadku nawracających infekcji dróg oddechowych stosowano w badaniach 
wydłużone leczenie np. trzytygodniową kurację azytromycyną (3 dni w trzech 
kolejnych tygodniach) opierając się na wynikach wskazujących, iż lO-dniowe leczenie 
jest niewystarczające. Uzyskano skuteczność kliniczną u wszystkich pacjentów 
z potwierdzonym atypowym zakażeniem [49]. 
Analizując skuteczność leczenia jedynie na podstawie ustąpienia objawów klinicznych 
należy jednak pamiętać o badaniach (Esposito i wsp.), w których nie podjęto leczenia 
u większości pacjentów z objawami zapalnymi w górnych drogach oddechowych 
i potwierdzonym zakażeniem C. pneumoniae, a mimo tego obserwowano ustąpienie 
objawów klinicznych [47]. 
W badaniach in vitro wykazano różny efekt terapeutyczny w stosunku do 
C. pneumoniae uzależniony od komórek będących gospodarzem dla patogenu. Badania 
oceniające skuteczność terapii in vitro z użyciem azytromycyny, klarytromycyny, 


37
		

/p0038.djvu

			tosufloksacyny oraz minocykliny, wykazały różną aktywność w stosunku do patogenu 
w różnych liniach komórkowych. Do badania użyto komórki Hep-2 (komórki 
nabłonkowe), monocyty THP-1, limfocyty T-Molt 4 oraz limfocyty B-P3HR1. Niestety 
żaden z badanych antybiotyków nie wykazał efektu terapeutycznego w stosunku do 
C. pneumoniae w limfocytach B. Badanie wykazało największą wrażliwość 
(najmniejszy MIC) w przypadku komórek nabłonkowych oraz prawie całkowity brak 
wpływu zastosowanej antybiotykoterapii na replikację patogenu w limfocytach. 
Badanie to pokazało, iż należy liczyć SIę z taką możliwością, iż eradykacja 
C. pneumoniae z komórek krwi obwodowej za pomocą dostępnych antybiotyków, jest 
niemożliwa [176]. 
Również inne badania, dotyczące wpływu antybiotykoterapii na nasilenie zmIan 
miażdżycowych w naczyniach, nie potwierdziły długotrwałego efektu. Dwuletnia 
terapia gatifloksacyną - dziesięciodniowe cykle powtarzane co miesiąc, u ponad 
4 tysięcy pacjentów z objawami ostrej choroby wieńcowej nie doprowadziła do 
zmniejszenia ilości zgonów, zawałów mięśnia sercowego oraz objawów niestabilnej 
choroby wieńcowej wymagającej rewaskularyzacji w porównaniu z grupą kontrolną. 
Podobnie miesięczna terapia roksytromycyną u pacjentów ze zmianami w tętnicach 
kończyn dolnych nie dała istotnej klinicznie poprawy. Ocenie poddawano jednak 
skuteczność kliniczną w odniesieniu do zmian miażdżycowych naczyń, a nie eradykację 
patogenu, co wobec nieustalonej roli C. pneumoniae w procesach miażdżycowych nie 
może być dowodem na brak skuteczności leczenia przeciwdrobnoustrojowego [22,92]. 


38
		

/p0039.djvu

			2. CELE PRACY 


1. Dokonanie oceny częstości występowania zakażeń Chlamydophila pneumoniae 
u dzieci. 


2. Charakterystyka objawów klinicznych 1 czynników ryzyka zakażeń 
Chlamydophila pneumoniae u dzieci. 


3. Ocena produkcji cytokin prozapalnych: IFN-y, IL-1
 i TNFa w zakażeniach 
Chlamydophila pneumoniae u dzieci. 


4. Ocena produkcji cytokiny przeciwzapalnej IL-10 w zakażeniach Chlamydophila 
pneumoniae u dzieci. 


5. Ocena wykładników gospodarki lipidowej (cholesterolu całkowitego, jego 
frakcji HDL i LDL oraz triglicerydów) w zakażeniach Chlamydophila 
pneumoniae u dzieci. 


39
		

/p0040.djvu

			3. MATERIAŁ I METODYKA 


3.1. Pacjenci 


3.1.1. Grupa badana 
Do badania włączono 202 dzieci (128 chłopców i 74 dziewczynki) w wieku od 
2 miesięcy do 16 lat (192 miesięcy), hospitalizowanych w Specjalistycznym Zespole 
Opieki Zdrowotnej nad Matką i Dzieckiem w Poznaniu, w okresie od maja 2007 r. do 
sierpnia 2008 r. z powodu choroby dróg oddechowych tj. infekcji górnych i dolnych 
dróg oddechowych oraz zaostrzenia astmy oskrzelowej. Nie włączono do badania tych 
dzieci, które w trakcie miesiąca poprzedzającego hospitalizację leczone były 
antybiotykiem potencjalnie skutecznym w stosunku do Chlamydophila pneumoniae. 
W celu analizy klinicznej i epidemiologicznej grupę badaną podzielono ze 
względu na wiek na cztery podgrupy, przedstawione w tabeli 1. 


Tab.1 Wiek dzieci w grupie badanej w momencie włączenia do badania. 


Wiek w miesiącach Liczba dzieci (n) Odsetek 
2-11 62 30% 
12-35 56 28% 
36-83 56 28% 
od 84 28 14% 


3.1.2. Grupa kontrolna 
Grupę kontrolną stanowiło 60 zdrowych dzieci (35 chłopców i 25 dziewczynek), 
w tym samym przedziale wiekowym co dzieci w grupie badanej, przyjmowanych na 
oddział chirurgiczny Specjalistycznego Zespołu Opieki Zdrowotnej nad Matką 
i Dzieckiem w Poznaniu, w celu wykonania planowego zabiegu oraz pacjentów 
z Poradni Konsultacyjnej ds. Szczepień. U pacjentów tych nie stwierdzano objawów 
infekcji układu oddechowego w momencie włączenia do badania. 


40
		

/p0041.djvu

			3.2. Schemat badania 


Ryc. 3 Schemat badania 


Grupa Z- z .. Grupa NZ- bez 
potwierdzonym potwierdzonego 
zakażeniem zakażenia 
C.pneumoniae (n=34) C.pneumoniae 
11- okres zdrowienia (n=l()R) 
(zakończenie hospitalizacji) 11- okres zdrowienia 
- analiza przebiegu (zakończenie hospitalizacji) 
k I i n i czn ego - analiza przebiegu 
- badanie Vl/Ybranych cytokin k I i n i czn ego 
- badanie przeciwciał przeciw 
\..ChJamydophiJa pneumoniae 
 \... 
 


I Grupa Z (n=23) 


41
		

/p0042.djvu

			3.2.1. Badanie podmiotowe 
U wszystkich dzieci w grupIe badanej oraz kontrolnej zebrano szczegółowy 
wywiad dotyczący: 
· charakteru oraz czasu trwania dolegliwości będących przyczyną zgłoszenia się 
do szpitala 
· stosowanego leczenia w trakcie miesiąca poprzedzającego hospitalizację 
· stosowanych przewlekle leków 
· współistniejących chorób przewlekłych 
· częstości występowania infekcji dróg oddechowych 
· uczęszczania do żłobka, przedszkola, szkoły 
· obecności rodzeństwa lub innych dzieci zamieszkujących wspólnie z badanym 
dzieckiem 


3.2.2. Badanie przedmiotowe 
W badaniu przedmiotowym szczególną uwagę zwrócono na: 
· zmiany osłuchowe nad polami płucnymi - oceniano charakter i symetrię szmeru 
oddechowego, czas trwania fazy wydechowej, obecność i kaliber rzężeń, 
występowanie innych zmian osłuchowych takich jak furczenia, świsty. 
· objawy duszności 
· objawy zapalenia górnych dróg oddechowych takich jak: obecność wydzieliny 
w przewodach nosowych oraz na tylnej ścianie gardła, zmiany patologiczne 
w obrębie gardła i migdałków gardłowych. 


3.2.3. Analiza przebiegu klinicznego 
Po zakończeniu hospitalizacji, u wszystkich pacjentów z grupy badanej, na 
podstawie dokumentacji medycznej przeprowadzono analizę przebiegu klinicznego 
choroby. Analizowano: 
· występowanie gorączki - za gorączkę uznawano temperaturę ciała 
powierzchowną > 38°C mierzoną w dole pachowym [65] 
· występowanie objawów duszności 
· zmiany osłuchowe nad polami płucnymi stwierdzane w trakcie hospitalizacji 
· objawy spoza układu oddechowego 
· potwierdzone badaniem otoskopowym zapalenie ucha środkowego 
· stosowaną antybiotykoterapię 


42
		

/p0043.djvu

			W grupie dzieci z potwierdzonym zakażeniem Chlamydophila pneumoniae, które 
zgłosiły się w celu wykonania kontrolnego wymazu z gardła w kierunku obecności ww. 
bakterii (n=23), przeprowadzono również analizę okresu od wypisania pacjenta ze 
szpitala do momentu kontroli. Szczególna uwagę zwracano na: 
· nawroty infekcji dróg oddechowych - częstość oraz charakter 
· stosowane leczenie, ze zwróceniem uwagi na antybiotyki potencjalnie 
skuteczne w stosunku do Chlamydophila pneumoniae 


3.2.4. Badania dodatkowe 
· badanie radiologiczne 
· ocena białka C-reaktywnego 
· oznaczenie immunoglobulin klas IgA, IgM i IgG 
· oznaczanie swoistych przeciwciał anty-C. pneumoniae 
· badania mikrobiologiczne 
· badania immunologiczne 
· badania wykładników gospodarki lipidowej 


3.2.4.1. Badanie radiologiczne 
Badanie radiologiczne klatki piersiowej w projekcji przednio-tylnej wykonywano 
w Zakładzie Radiologii Specjalistycznego Zespołu Opieki Zdrowotnej nad Matką 
i Dzieckiem w Poznaniu, przy użyciu aparatu Simens Multix TOP. 
Zdjęcia radiologiczne analizowane były przez lekarza radiologa pod kątem obecności 
zmian zapalnych w obrębie pól płucnych, ich rozległości, lokalizacji, występowania 
odczynu opłucnowego, zmian niedodmowych, zaburzeń wentylacji obwodowej, oceny 
sylwetki serca. 
U dzieci, u których istniały wskazania kliniczne wykonano zdjęcie radiologiczne 
zatok oceniając obecność płynu oraz odczynu zapalnego ze strony śluzówek. 


43
		

/p0044.djvu

			3.2.4.2. Oznaczenie białka C-reaktywnego 
U wszystkich pacjentów z grupy badanej wykonano przy przyjęciu do szpitala, 
zgodnie z obowiązującymi standardami szpitalnymi, ocenę białka C-reaktywnego, jako 
wykładnika nieswoistej reakcji zapalnej. Oznaczenie białka C-reaktywnego wykonano 
w Zakładzie Diagnostyki Laboratoryjnej Specjalistycznego Zespołu Opieki Zdrowotnej 
nad Matką i Dzieckiem w Poznaniu. 
Stężenie białka C-reaktywnego oznaczano stosując metodę 
immunoturbidymetryczną; wykorzystywano analizator biochemiczny Cobas Integra. 
Stężenie określano w mg/l; norma do 5 mg/l. 


3.2.4.3. Oznaczenie głównych klas immunoglobulin 
U pacjentów, u których wywiad lub przebieg kliniczny infekcji mógł sugerować 
zaburzenia odporności wykonano oznaczenie immunoglobulin w zakresie klas 
głównych: A (IgA), M (IgM) i G (IgG). Badania przeprowadzono w Zakładzie 
Diagnostyki Laboratoryjnej Specjalistycznego Zespołu Opieki Zdrowotnej nad Matką 
i Dzieckiem w Poznaniu. 
Stężenie IgA, IgM i IgG oznaczano stosując metodę immunoturbidymetryczną; 
wykorzystywano analizator biochemiczny Cobas Integra. Stężenie określano w g/l; 
analizowano z uwzględnieniem obowiązujących w oznaczającym laboratorium norm 
z uwzględnieniem wieku pacjenta. 


3.2.4.4. Oznaczenie przeciwciał przeciw Chlamydophila pneumoniae 
Oznaczenia swoistych przeciwciał anty-C. pneumoniae w klasach IgA, IgM i IgG 
wykonano u 28 pacjentów z grupy z potwierdzonym, metodą biologii molekularnej 
(nested-PCR), zakażeniem Chlamydophila pneumoniae. Badania przeprowadzono 
w Pracowni Badań Ogólnych Działu Laboratoryjnego Wojewódzkiej Stacji Sanitarno- 
Epidemiologicznej w Poznaniu z zastosowaniem pośredniej metody 
immunoenzymatycznej ElA (Ani Labsystems, Finlandia). Technika ta oparta jest na 
łączeniu przeciwciał z surowicy pacjenta z antygenem C. pneumoniae, opłaszczającym 
polistyrenową fazę stałą. Po odpłukaniu niepołączonych substratów nakładane są 
anty-ludzkie immunoglobuliny (owcze) skoniugowane z peroksydazą chrzanową, 
odpowiednio dla każdej klasy analizowanych przeciwciał. Po dodaniu bezbarwnego 


44
		

/p0045.djvu

			substratu w postaci nadtlenku wodoru (H 2 0 2 ) oraz chromogenu dla peroksydazy 
chrzanowej TMB (tetrametylbenzydyna), powstaje barwny produkt. Reakcja hamowana 
jest nałożeniem kwasu siarkowego (H 2 S0 4 ). Intensywność barwy produktu jest wprost 
proporcjonalna do stężenia przeciwciał anty-C. pneumoniae w próbie badanej. Wartość 
absorbancji odczytywano przy długości fali A= 450nm. Technika ElA C. pneumoniae 
Ani Labsystems dla oceny IgM, IgG i IgA w surowicy pacjenta pozwala na rozróżnienie 
zakażenia ostrego od przebytej w przeszłości lub w ostatnim czasie infekcji, zakażenia 
przewlekłego albo okresu zdrowienia. W przypadku pierwotnego ostrego zakażenia 
immunoglobuliny w klasie IgM prezentują wartości dodatnie, natomiast podczas 
reinfekcji ujemne. Reinfekcja charakteryzuje się szybką odpowiedzią w zakresie IgG 
i/lub IgA. Odpowiedź IgG rozwija się wolniej, zwłaszcza, gdy u pacjenta zastosowano 
antybiotykoterapię. Poziom stały lub obniżający się w zakresie IgG i/lub IgA, 
z wartościami ujemnymi dla IgM, wskazywać może na przebytą infekcję, zakażenie 
przewlekłe albo okres zdrowienia. Czułość metody immunoenzymatycznej ElA (Ani 
Labsystems) oceniana jest na poziomie 96%, a swoistość 99%. 


3.2.4.5. Badania mikrobiologiczne 
Materiał badawczy, służący do rozpoznanIa zakażenia Chlamydophila 
pneumoniae, stanowił wymaz z tylnej ściany gardła pobierany od każdego pacjenta 
z grupy badanej (n=202) oraz z grupy kontrolnej (n=60). Wymaz z gardła wykonano 
ponownie u 23 pacjentów, ze stwierdzonym w trakcie hospitalizacji zakażeniem 
C. pneumoniae, którzy zgłosili się na badanie kontrolne w okresie zdrowienia, w czasie 
7 do 20 miesięcy po pierwszym badaniu [83, 160]. Materiał z tylnej ściany gardła 
pobierano na wymazówkę wykonaną z wysoko oczyszczonej bawełny, którą 
umieszczano w podłożu transportowym (Stuart medium, Meus Italy). W Katedrze 
i Zakładzie Mikrobiologii Lekarskiej UM w Poznaniu, pobrany materiał komórkowy 
umieszczano w 1,5 mI jałowej probówce (Eppendorf), a następnie poddawano obróbce 
i badaniom molekularnym. 


3.2.4.5.1. Ekstrakcja DNA Chlamydophila pneumoniae 
Całkowite DNA izolowano metodą kolumienkową, opartą na zdolności wiązania 
DNA do krzemionki w wysokich stężeniach soli chaotropowych, przy użyciu zestawu 
Swab (A&A Biotechnology). Do probówki dodawano 0,7 mI roztworu lizującego i 20 

l proteinazy K. Całość worteksowano i inkubowano w temperaturze 37°C przez 20 


45
		

/p0046.djvu

			minut. Roztwór z probówki nanoszono na kolumnę do oczyszczania DNA i wirowano 
1 min. przy 10-15 tys. obr/min. Kolumnę przenoszono do 2 mI probówki i dodawano 
0,5 mI roztworu płuczącego. Po kolejnym wirowaniu przez 1 min. przy 10-15 tys. 
obr/min, kolumnę przenoszono do nowej probówki 2 mI i dodawano 0,5 mI roztworu 
płuczącego. Wirowano 2 min. przy 10-15 tys. obr/min. Osuszoną minikolumnę 
umieszczano w nowej jałowej probówce 1,5 mI (Eppendorf) i na dno kolumny 
dodawano 150 
l buforu elucyjnego (10mM TRIS.HCI, pH 8,5) uprzednio ogrzanego 
do temperatury 75°C. Po 3-minutowej inkubacji w temperaturze pokojowej, probówkę 
wirowano 1 min. przy 10-15 tys. obr/min. Minikolumnę usuwano, a oczyszczone DNA 
w probówce przechowywano w temperaturze 4 oC do czasu dalszych analiz. 


3.2.4.5.2. Oznaczanie obecności DNA Chlamydophila pneumoniae metodą 
nested-PCR 


Przygotowany DNA stanowił matrycę do łańcuchowej reakcji polimerazy 
w układzie nested. Nested-PCR polega na przeprowadzeniu dwóch kolejnych reakcji 
PCR, w której produkt reakcji out stanowi substrat w reakcji in. Stosowane są dwie 
pary starterów. Łańcuchowa reakcja polimerazy (PCR) pozwala na amplifikację 
wybranej sekwencji genomowego DNA, z zastosowaniem syntetycznej pary 
oligonukleotydów (Ryc.4). W celu stwierdzenia obecności DNA Chlamydophila 
pneumoniae w materiale diagnostycznym zastosowano dwie pary starterów dla 
fragmentu genu OmpA, kodującego główne białka błony zewnętrznej MOMP (DNA- 
Gdańsk II). 


Starter Amplifikowany Sekwencja 5'.3' Wielkość 
region produktu 
reakcja out Chp 424A CAACAGACGCTGGCGTAGCAAC 
Chp 424B Fragment genu OmpA TGAACTGACCAGATACGTGAGCAG 424 bp 
(amplifikacja) 
(kodujący MOMP) 
reakcja in Chp 147A AACTTTTGATGCTGATAACATC 
147 bp 
(reamplifikacja) Chp 147B GAAACAATTTGCATGAAGTCT 


Do reakcji amplifikacji PCR w układzie nested (reakcja out) użyto 3 fll 
wyizolowanego DNA całkowitego z próbek badanych i 47 fll mieszaniny odczynników: 
starterów (Chp424A, Chp424B), dNTP (10 mM), termostabilną Taq polimerazę (1,5 U) 
i bufor PCR (10x z 25 mM MgCI 2 ) (DNA-Gdańsk II). Całkowita objętość mieszaniny 
reakcyjnej stanowiła 50 fll. Dla każdej serii badań wykonywano kontrolę pozytywną 


46
		

/p0047.djvu

			oraz negatywną. W przypadku kontroli negatywnej w mIeJsce matrycowego DNA 
dodawano równoważną objętość buforu TE (10 mM Tris-CI pH 8,0; 1 mM EDTA). 
Do reakcji reamplifikacji PCR w układzie nested (reakcja in) użyto 2 fll 
produktu PCR otrzymanego w amplifikacji wstępnej i 48 fll mieszaniny odczynników: 
starterów (Chp147A, Chp147B), dNTP (10 mM), termostabilną Taq polimerazę (1,5 U) 
i bufor PCR (10x z 25 mM MgCI 2 ) (DNA-Gdańsk II). Dla każdej serii badań 
wykonywano kontrolę pozytywną (DNA z hodowli komórkowej szczepu wzorcowego; 
DNA-Gdańsk II) oraz negatywną, w których zastosowano po 2 fll produktów PCR 
kontroli pozytywnej i negatywnej odpowiednio, uzyskanych w amplifikacji wstępnej. 
Do przeprowadzenia obydwu reakcji nested-PCR zastosowano aparat 
Mastercycler Pro S (Eppendorf). 
Reakcja amplifikacji fragmentu badanego genu OmpA w układzie nested-PCR 
(reakcja out) dla Chlamydophila pneumoniae, przebiegała w następujących etapach: 


- wstępna denaturacja DNA 


- 94 oC I 5 min 


- denaturacja dwuniciowego DNA 
- przyłączanie starterów do miejsc komplementarnych 
na matrycy (annealing) 
- synteza komplementarnej nici DNA przez sukcesywne 
przyłączanie dNTP, proces katalizowany przez polimerazę Taq 
wobec jonów Mg 2 + (elongacja) 


- 94 oC I 30 s 


- 58 oC I 120 s 
- 72 oC I 30 s 


40x 


- wydłużanie końcowe (synteza komplementarnej nici DNA) 


- 72 oC I 5 min 


Warunki reakcji reamplifikacji - reakcja in dla C. pneumoniae były następujące: 


- wstępna denaturacja DNA 


- 94 oC I 5 min 


- denaturacja DNA 
- przyłączanie starterów 
- elongacja 


- 94 oC I 30 s 
- 47 oC I 90 s 
- 72 oC I 30 s 


40x 


- wydłużanie końcowe 


- 72 oC I 5 min 


47
		

/p0048.djvu

			Powtórzenie cykli prowadzi do zwielokrotnienia poszukiwanego fragmentu DNA. 
Produkty po pierwszej i drugiej reakcji nested-PCR analizowano jakościowo 
z zastosowaniem elektroforezy na żelu agarozowym (2 % z dodatkiem 1 fll bromku 
etydyny) w 1 % buforze TAE (Tris-Acetate EDTA buffer, pH 8,3 w 1000 mI H 2 0; 
Millipore) przy natężeniu prądu 60 mA przez 1 godzinę. Na żel nakładano wzorzec 
wielkości 100-500 bp (DNA-Gdańsk II), kontrolę pozytywną, kontrolę negatywną oraz 
próby badane. Elektroforezę przeprowadzano zarówno po reakcji amplifikacji jak 
i reamplifikacji. Wynik odczytywano na podstawie obecności prążków widocznych na 
żelu w świetle lampy UV. Po reakcji out wynik uważa się za pozytywny jeśli w żelu 
stwierdza się obecność produktu PCR o wielkości 424 bp (wskutek dużego jego 
stężenia). W przeprowadzonych badaniach nie stwierdzono jego obecności. 
W przypadku reakcji in (reamplifikacja) wynik testu jest pozytywny tzn. stwierdza się 
obecność DNA C. pneumoniae jeżeli obecne są prążki o wielkości 147 bp, ich brak 
świadczy o wyniku ujemnym. Obraz rozdziału elektroferetycznego rejestrowano przy 
pomocy cyfrowego systemu dokumentacji żeli (Doc-It LS Image Analysis, UVP). 


Ryc.4 Schemat reakcji nested-PCR. 


SekvIfencja doceImva 

 
 


Mabyca DNA. 



 


Pietwsza palii sIadeniw 


- 


łJr. 


-4 


- 



 


reakcja out 



 
PmcUcI po petwszej 
makt:ji PCR 

 SekvIfencja doceImva 

 palii sIadeniw 
 
 

 
+ - 

 SekvIfencja doceImva 
+ + 
- .
 in 
- 

 SekvIfencja doceImva 
+ + 
PmcUcI po Wgej 
makt:ji PCR 


48
		

/p0049.djvu

			3.2.4.6. Oznaczanie badanych cytokin: IFN-y, IL-1p, TNF-a i IL-10 
Oznaczenia wybranych cytokin wykonano w surowicy krwi obwodowej, 
pobieranej w ramach rutynowych badań diagnostycznych od każdego dziecka 
z potwierdzonym zakażeniem C. pneumoniae oraz z grupy kontrolnej. 
Celem analizy stężenia wybranych cytokin, dzieci ze stwierdzonym zakażeniem 
C. pneumoniae, podzielono na dwie grupy wiekowe oraz odpowiadające im wiekowo 
wyselekcjonowane grupy dzieci zdrowych (grupy kontrolne): 
· grupa 1 - obejmująca 20 dzieci ze stwierdzonym zakażeniem C. pneumoniae 
< 3 roku życia 
· grupa 1K (grupa kontrolna) - obejmująca 12 dzieci zdrowych < 3 roku życia 
· grupa 2 - obejmująca 14 dzieci ze stwierdzonym zakażeniem C. pneumoniae 
> 3-13 roku życia 
· grupa 2K (grupa kontrolna) - obejmująca 15 dzieci zdrowych> 3 roku życia 
Dzieci ze stwierdzonym zakażeniem Chlamydophila pneumoniae badano 
dwukrotnie w ostrym okresie choroby (I termin) oraz okresie zdrowienia (II termin). 


3.2.4.6.1. Oznaczanie surowiczego IFN-y 
Oznaczenia surowIczego IFN -y wykonano w surowIcy krwi metodą 
immunoenzymatyczną (ELISA), przy użyciu zestawu o wysokiej czułości - Human 
High Sensitivity Interferon Gamma ELISA Kit (Abcam) o średniej minimalnej 
wykrywalności (MDD) <0,69 pg/ml. Na studzienki mikropłytki, opłaszczone 
biotynylowanymi swoistymi monoklonalnymi przeciwciałami przeciwko IFN-y, 
nanoszono roztwory standardów (rekombinowany ludzki IFN-y) o znanych stężeniach 
IFN-y oraz próby badane. IFN-y, jeśli obecny był w badanej próbie, łączył się swoiście 
z przeciwciałami, a pozostałe substancje wypłukiwano. Następnie dodawano enzym 
(streptawidyna-peroksydaza chrzanowa), którego działanie prowadziło do reakcji 
polimeryzacji w miejscu łączenia enzymu do przeciwciała wykrywającego. 
Wartość absorbancji odczytywano przy długości fali A= 450nm z zastosowaniem 
czytnika Reader 250 (bioMerieux). Wyniki obliczano na podstawie wyznaczonej 
krzywej standardowej. Intesywność barwy produktu była wprost proporcjonalna do 
stężenia interleukiny w próbach badanych. 


49
		

/p0050.djvu

			Cytokiny surowicze IL-1
, TNF-a i IL-10 oznaczono ilościową "kanapkową" 
metodą immunoenzymatyczną ELISA, przy użyciu zestawów o wysokiej czułości 
Quantikine HS Human Immunoassay (R&D Systems). Na studzienki mikropłytki, 
opłaszczone swoistymi monoklonalnymi przeciwciałami przeciwko badanej cytokinie, 
nanoszono roztwory standardów (rekombinowana ludzka interleukina) oraz próby 
badane. Cytokiny, w przypadku ich obecności w badanej próbie, łączyły się swoiście 
z przeciwciałami, a pozostałe substancje wypłukiwano. Następnie dodawano 
poliklonalne przeciwciała swoiste dla cytokiny badanej, związane z alkaliczną 
fosfatazą. Po wypłukaniu niepołączonych związków, dodaniu substratu (roztworu 
NADPH) i wzmacniaczy enzymów aktywujących reakcję redox, powstawało 
zabarwienie, którego intesywność była wprost proporcjonalna do stężenia interleukiny 
w próbach badanych. Reakcję hamowano roztworem kwasu siarkowego. Absorbancję 
odczytywano w spektrofotometrze Reader 250 (bioMerieux), przy odpowiedniej 
długości fali A. 


3.2.4.6.2. Oznaczanie surowiczej IL-1p 
Oznaczenia IL-1 
 wykonano w surowicy krwi metodą immunoenzymatyczną 
(ELISA), przy użyciu zestawu o wysokiej czułości - Quantikine HS Human IL-1 
/IL- 
1F2 Immunoassay (R&D Systems) o średniej minimalnej wykrywalności (MDD) 
równej 0,057 pg/ml. 
Wartość absorbancji odczytywano przy długości fali A= 490nm z zastosowaniem 
czytnika Reader 250 (bioMerieux). Wyniki obliczano na podstawie wyznaczonej 
krzywej standardowej. 


3.2.4.6.3. Oznaczanie surowiczego TNF-u 
Oznaczenia TNF-a wykonano w surowicy krwi metodą immunoenzymatyczną 
(ELISA), przy użyciu zestawu o wysokiej czułości Quantikine HS Human TNF- 
a/TNFSF1A Immunoassay (R&D Systems), charakteryzujący się średnią minimalną 
wykrywalnością (MDD) równą 0,106 pg/ml. 
Wartość absorbancji odczytywano przy długości fali A= 490nm z zastosowaniem 
czytnika Reader 250 (bioMerieux). Wyniki obliczano na podstawie wyznaczonej 
krzywej standardowej. 


50
		

/p0051.djvu

			3.2.4.6.4. Oznaczanie surowiczej IL-10 
Oznaczenia IL-10 wykonano w surowicy krwi metodą immunoenzymatyczną 
(ELISA), przy użyciu zestawu o wysokiej czułości Quantikine HS Human IL-10 
Immunoassay (R&D Systems), charakteryzujący się średnią minimalną wykrywalnością 
(MDD) równą 0,5 pg/ml. 
Absorbancję odczytywano przy długości fali A= 490nm z zastosowaniem czytnika 
Reader 250 (bioMerieux). Wyniki obliczano na podstawie wyznaczonej krzywej 
standardowej. 


3.2.4.7. Oznaczanie wykładników gospodarki lipidowej 
Ocenę wykładników gospodarki lipidowej wykonano, podobnie jak w przypadku 
oznaczeń cytokin, w surowicy krwi obwodowej, pobieranej w ramach rutynowych 
badań diagnostycznych, od każdego dziecka z potwierdzonym zakażeniem 
C. pneumoniae oraz z grupy kontrolnej. 
W surowicy krwi dokonano oznaczenia cholesterolu całkowitego, cholesterolu 
frakcji HDL oraz triglicerydów (TG) z zastosowaniem techniki suchej chemii 
i analizatora biochemicznego Reflotron Plus (Boehringer Mannheim). 
Próby badane poddawane były różnemu czasowi inkubacji w zależności od 
oznaczenIa w celu określonych przemian chemicznych, a wynik odczytywano 
automatycznie na analizatorze biochemicznym za pomocą fotometru (reflotrance 
photometr) przy długości fali A= 642 nm. 
Paski testowe zawierały odczynniki dla badanego parametru, w ilości na cm 2 . 


Reflotron cholesterol: 
- esteraza cholesterolu> 1,2 U 
- oksydaza cholesterolu> 0,1 U 
- peroksydaza (POD) > 1,1 U 
- wskaźnik: 60 flg 
- bufor 


Zakres pomiaru: 100 - 500 mg/dl (2,59 - 12,9 mmol/l) 


51
		

/p0052.djvu

			Reflotron HDL: 
- uwodniony octan magnezu 264 flg 
- siarczan dekstranu 32,5 flg 
- oksydaza askorbinianowa > 0,06 U 
- esteraza cholesterolu > 0,8 U 
- oksydaza cholesterolu > 0,05 U 
- peroksydaza > 0,3 U 
- wskaźnik: 4,8 flg 
- bufor 
Zakres pomiaru: 10 - 100 mg/dl (0,26 - 2,59 mmol/l) 


Reflotron TG: 
- esteraza > 0,5 U 
- glicerokinaza > 1,2 U 
- oksydaza glicerofosforanowa > 0,1 U 
- peroksydaza > 0,7 U 
- ATP: 68 flg 
- wskaźnik: 51 flg 
- bufor 
Zakres pomiaru: 70 - 600 mg/dl (0,8 - 6,86 mmol/l) 
Stężenie cholesterolu frakcji LDL wyliczano na podstawie wzoru Fridewalda: 


Ch LDL = Ch całkowity - Ch HDL - 0,2 X TG [mg/dl] 


52
		

/p0053.djvu

			3.3. Analiza statystyczna 
Analizę wyników badań prowadzono przy zastosowaniu programu 
komputerowego STATISTICA v. 8 firmy StatSoft. 


3.3.1. Metodyka opracowania statystycznego w zakresie analizy struktury 
badanej populacji i obrazu klinicznego 
Przy analizowaniu danych ilościowych zastosowane zostały wartości średniej 
i odchylenia standardowego. Z uwagi na brak normalności rozkładu weryfikacja różnicy 
wieku w grupach dzieci z dodatnim i ujemnym wynikiem przeprowadzona została 
analiza przy użyciu testu Manna- Whitneya. 
Cechy jakościowe scharakteryzowane zostały przez podanie liczby 1 odsetka 
jednostek reprezentujących poszczególne kategorie cech. 
Do weryfikacji różnic pomiędzy częstościami występowania różnych cech 
w grupach z dodatnim i ujemnym wynikiem badania użyty został test dla różnic między 
dwoma wskaźnikami struktury. 
Różnice były uznawane za istotne statystycznie, jeżeli poziom p był mniejszy od 
0,05. 


3.3.2. Analiza statystyczna wyników badań mikrobiologicznych, 
immunologicznych i wykładników gospodarki lipidowej 
Występowanie cechy C. pneumoniae dodatnie (+) u badanych dzieci, 
analizowano przy użyciu dokładnego testu Fishera. 
W analizie porównawczej poziomów cytokin w badanych grupach zastosowano 
test nieparametryczny Kruskala- Wallisa z testem Dunna. Test rangowy Kruskala- 
Wallisa sprawdza czy w układzie kilku grup znajdą się 2 grupy, które różnią się między 
sobą istotnie. W przypadku uzyskania wyniku istotnego stosowano test Dunna, który 
wykrywa różniące się między sobą grupy. 
Analizę statystyczną wykładników gospodarki lipidowej przeprowadzono za 
pomocą testu Manna- Whitneya. 
Hipotezy statystyczne weryfikowano na poziomie istotności p<0,05. 


53
		

/p0054.djvu

			Podział zadań badawczych: 


Joanna Stryczyńska- Kazubska 


· kwalifikacja dzieci do badania (grupa badana i kontrolna) oraz pobieranie 
wymazu z gardła 
· analiza epidemiologiczna zakażeń Chlamydophila pneumonlae u dzieci 
hospitalizowanych z powodu stanu zapalnego w obrębie górnych 
i dolnych dróg oddechowych oraz zaostrzenia astmy oskrzelowej 
· analiza przebiegu klinicznego zakażeń Chlamydophila pneumoniae 
u dzieci 
· prównanie przebiegu klinicznego stanu zapalnego dróg oddechowych 
u dzieci z potwierdzonym zakażeniem Chlamydophila pneumoniae z grupą 
dzieci bez zakażenia ww. patogenem 


Barbara Zwoździak 


· diagnostyka mikrobiologiczna zakażeń Chlamydophila pneumoniae 
· oznaczanie cytokin: IFNy, IL-1
, TNFa, IL-10 w surowicach chorych dzieci 
· oznaczanie wykładników gospodarki lipidowej: cholesterolu całkowitego, 
frakcji HDL, LDL i TG w surowicach chorych dzieci 


Na prowadzenie badań uzyskano zgodę Komisji Bioetycznej przy 
Uniwersytecie Medycznym im. K. Marcinkowskiego w Poznaniu, dnia 08.11.2007 
roku, uchwała nr 989/07. 


W przypadku wszystkich badanych pacjentów, rodzice lub prawni opiekunowie 
otrzymali informacje, dotyczące celu badań (załącznik nr 1) oraz wyrazili świadomą, 
pisemną zgodę na udział w badaniach (załącznik nr 2). 


54
		

/p0055.djvu

			ZAŁĄCZNIK 1. 


INFORMACJA DLA PACJENTA 


Zakażenia Chlamydophila pneumoniae dzieci mogą być przyczyną ostrych, 
przewlekłych oraz nawracających stanów zapalnych górnych i dolnych dróg 
oddechowych. Leczenie zakażenia wywołanego przez te drobnoustroje wymaga 
stosowania wybranych antybiotyków. Jednak charakterystyka zespołów klinicznych 
związanych z zakażeniem Chlamydophila pneumoniae nadal nie jest pełna. 
Celem prowadzonego badania jest analiza przebiegu klinicznego zakażeń dróg 
oddechowych wywołanych przez Chlamydophila pneumoniae. 
Badania oparte są na aktualnych światowych doniesieniach, i poza obserwacją 
kliniczną dzieci, dotyczą również oznaczania wybranych cytokin, mających 
prawdopodobnie wpływ na przebieg procesu chorobowego. 
Materiałem diagnostycznym służącym do rozpoznania zakażenia oraz 
oznaczenia ww. substancji jest wymaz z gardła i krew, uzyskana w trakcie diagnostyki 
rutynowo przeprowadzanej w czasie hospitalizacji dziecka. Badania te, oparte 
o nowoczesne metody diagnostyczne, mogą w istotny sposób przyczynić SIę do 
znalezienia przyczyny obecnego zakażenia oraz przeprowadzenia skutecznej terapii. 
Pobrany od dzieci materiał diagnostyczny zostanie wykorzystany tylko do celów 
niniejszego badania. 
Badanie to nie ma znamion eksperymentu ani doświadczenia na chorym. 


55
		

/p0056.djvu

			ZAŁĄCZNIK 2. 


FORMULARZ ŚWIADOMEJ ZGODY 


Temat badania: Obraz kliniczny oraz ocena wybranych cytokin w zakażeniach 
Chlamydophila pneumoniae u dzieci. 


Zostaliście poproszeni Państwo o wyrażenie zgody na udział Państwa 
dziecka (podopiecznego) w badaniu dotyczącym diagnostyki oraz przebiegu 
zakażeń wywołanych przez bakterie Chlamydophila pneumoniae. 
Przed podpisaniem zgody uprzejmie prosimy o zapoznanie się z załączoną 
informacją dotyczącą celu i sposobu przeprowadzenia badania. 
Jednocześnie informujemy, iż brak Państwa zgody na udział dziecka w badaniu nie 
wpłynie w żaden sposób na dalsze leczenie dziecka na oddziale szpitalnym. 


OŚWIADCZENIE RODZICA ( PRAWNEGO OPIEKUNA) 


Oświadczam, iż zapoznałam(em) SIę z informacjami na temat celu oraz sposobu 
przeprowadzania niniejszego badania. Zostałam(em) poinformowana(y) o możliwości 
odmowy wyrażenia zgody na udział mojego dziecka w badaniu oraz wycofania jej 
w każdej chwili trwania badania. 


Nazwisko i imię osoby badanej:................................................................................... 
Data urodzenia: .............................................................................................................. 


Data i podpis rodzica ( prawnego opiekuna) .................................................................. 


Data i podpis lekarza, w obecności którego została wyrażona zgoda............................. 


56
		

/p0057.djvu

			4. WYNIKI I ICH OMÓWIENIE 


4.1. Epidemiologia zakażeń Chlamydophila pneumoniae 


4.1.1. Częstość występowania zakażenia Chlamydophila pneumoniae 


4.1.1.1. Grupa badana 
W grupie badanej (n=202), bez uwzględnienia podziału na podgrupy wiekowe 
oraz rozpoznanie kliniczne, zakażenie Chlamydophila pneumoniae potwierdzono u 34 
dzieci tj. u 17% (grupa Z), ujemny wynik badania wymazu z gardła uzyskano u 168 
dzieci (grupa NZ). Wyniki przedstawiono na rycinie 5. 


4.1.1.2. Grupa kontrolna 
W grupie kontrolnej (dzieci zdrowe) zakażenie Chlamydophila pneumoniae 
potwierdzono u 2 z 60 badanych dzieci, tj u 3% (rycina 6). 
Uzyskano znamienną statystycznie różnicę w zakresie częstości występowania 
zakażenia Chlamydophila pneumoniae w grupie dzieci z infekcjami układu 
oddechowego w porównaniu z dziećmi zdrowymi (p=0,007). 


Ryc.5 Częstość występowania zakażenia Chlamydophila pneumoniae w grupie badanej. 


57
		

/p0058.djvu

			Ryc.6 Częstość występowania zakażenia Chlamydophila pneumoniae w grupie kontrolnej. 


4.1.2. Częstość występowania zakażenia Chlamydophila pneumoniae w zależności 
od wieku 
U stalono częstość występowania zakażenia Chlamydophila pneumoniae wśród 
dzieci z chorobami układu oddechowego w wydzielonych podgrupach wiekowych, 
uwzględniając podział na okres niemowlęcy - grupa 1 (2-11 miesięcy), wczesnego 
dzieciństwa - grupa 2 (12-35 miesięcy), okres przedszkolny-grupa 3 (36-83 miesięcy) 
oraz szkolny-grupa 4 (od 84 miesięcy), które stanowiły odpowiednio 30%, 28%, 28% 
i 14% grupy badanej. 
Częstość występowania zakażenia w poszczególnych grupach wiekowych 
przedstawiono w tabeli 2 oraz na rycinie 7. N a rycinie 8 przedstawiono procentowy 
udział podgrup wiekowych w grupie z potwierdzonym zakażeniem. Rycina 9 obrazuje 
odsetek dzieci zakażonych w badanych podgrupach wiekowych. 
Mimo, iż odsetek dzieci z potwierdzonym zakażeniem jest najwyższy w grupIe 
niemowląt (47%), różnice znamienne statystycznie wykazano jedynie przy porównaniu 
grupy 1 vs. 3 (p=0,007). U dzieci w okresie niemowlęcym znamiennie częściej 
stwierdzano zakażenie Chlamydophila pneumoniae w porównaniu z dziećmi 
przedszkolnymi. 
W grupie Z wiek dzieci jest istotnie niższy niż w grupie NZ (p=0,033). 


58
		

/p0059.djvu

			Tab.2 Ilość oraz odsetek dzieci z zakażeniem C. pneumoniae w poszczególnych grupach 
wiekowych. 


Liczba dzieci z Odsetek dzieci 
Grupa wiekowa Liczba dzieci potwierdzonym zakażonych w grupach 
badanych zakażeniem wiekowych (%) 
1 62 16 26 
2 56 10 18 
3 56 4 7 
4 28 4 14 


Ryc.7 Liczba dzieci z potwierdzonym zakażeniem C. pneumoniae oraz bez zakażenia 
w grupach wiekowych. 


70 


. grupa NZ 
. grupa Z 


60 


50 


40 


30 


20 


10 


O 


2-11 m. 


12-35 m. 


36-83 m. 



4m. 


59
		

/p0060.djvu

			Ryc.8 Udział poszczególnych podgrup wiekowych w grupie zakażonej C. pneumoniae. 


Ryc.9 Odsetek dzieci z zakażeniem C. pneumoniae w podgrupach wiekowych. 


30% 
25% 
20% 
15% 
10% 
5% 
0% 


p=O/007 


. zakażenie C.p. 


2-11 m. 


12-35 m. 


36-83 m. 



4m. 


60
		

/p0061.djvu

			4.1.3. Częstość występowania zakażenia Chlamydophila pneumoniae w zależności 
od płci 
Nie stwierdzono istotnych różnic rozkładu płci pomiędzy grupą 
z potwierdzonym zakażeniem C.pneumoniae, a dziećmi z zakażeniami układu 
oddechowego o innej etiologii (tabela 3). Chłopcy stanowili 53%, a dziewczynki 47% 
grupy dodatniej. 


Tab.3 Częstość występowania zakażenia Chlamydophila pneumoniae w zależności od płci 


Płeć Wynik Razem 
uJemny dodatni 
M 110 18 128 
(86% ) (14%) (100%) 
Z 58 16 74 
(78%) (22% ) (100%) 
P NS 


4.1.4. Wpływ chorób przewlekłych na częstość zakażeń Ch lamydoph ila 


. 
pneumonzae 
W analizie dotyczącej epidemiologii zakażeń Chlamydophila pneumoniae u dzieci 
uwzględniono zależność pomiędzy występowaniem chorób przewlekłych a częstością 
zakażenia. Analizowano związek z wadami układu krążenia, chorobami o podłożu 
alergicznym, przewlekłymi chorobami układu nerwowego, niedoborami odporności 
oraz przewlekłymi chorobami układu oddechowego. 
Wady układu krążenia stwierdzono u 4 z 202 (2%) badanych pacjentów, 
u wszystkich pod postacią ubytku w przegrodzie międzyprzedsionkowej (ASD). 
U żadnego z tych dzieci nie potwierdzono zakażenia C. pneumoniae. 
Choroby o podłożu alergicznym występowały u 21 z 202 pacjentów (10%). 
U 11 dzieci rozpoznano atopowe zapalenie skóry, u pozostałych objawy alergii ze 
strony przewodu pokarmowego oraz układu oddechowego. Z grupy tej wyłączono 
dzieci z astmą oskrzelową, uwzględniając to rozpoznanie w osobnej grupie ze względu 
na podawany przez wielu autorów związek pomiędzy zakażeniem C. pneumoniae a tym 
schorzeniem. Dzieci z chorobami alergicznymi stanowiły odpowiednio 11 % i 9% grupy 
niezakażonej i zakażonej, bez różnicy znamiennej statystycznie pomiędzy grupami. 


61
		

/p0062.djvu

			Zaburzenia odporności 


potwierdzono 


u 


4 


z 


202 


. 
 
pacJentow 


(2% ). 


Nieprawidłowości dotyczyły odporności humoralnej w zakresie głównych klas 
immunoglobulin: u jednego pacjenta stwierdzono niedobór immunoglobulin w klasie 
M, u jednego w klasie A i M, u dwóch hipogammaglobulinemię obejmującą klasę G, 
M oraz A. U wszystkich dzieci ze zdiagnozowanym niedoborem odporności 
potwierdzono zakażenie C. pneumoniae. Pacjenci ci stanowili 12% grupy zakżonej. 
Stwierdzono znamienną różnicę dotyczącą częstości zakażenia C. pneumoniae w grupie 
dzieci z niedoborami odporności i bez (p=0,002). 
Przewlekłe choroby układu oddechowego stwierdzono u 12 dzieci, co stanowiło 
6% grupy badanej. 11 z nich to dzieci z rozpoznaną astmą oskrzelową, u jednego 
rozpoznano włóknienie płuc. U 10 dzieci z przewlekłą chorobą układu oddechowego 
nie potwierdzono zakażenia C. pneumoniae, w przypadku 2 otrzymano wynik dodatni 
(jedno dziecko z astmą oskrzelową oraz jedno z włóknieniem płuc). Nie stwierdzono 
większej częstości występowania zakażenia C. pneumoniae u dzieci z astmą 
oskrzelową. 
W analizie uwzględniono również przewlekłe schorzenia układu nerwowego, 
biorąc pod uwagę możliwy wpływ patologii tego układu na wentylację. Spośród 
6 dzieci z w tej grupie u 5 stwierdzono zaburzenia rozwoju psychoruchowego, przy 
czym u 4 rozpoznawane jako dziecięce porażenie mózgowe, a u 1 będące wynikiem 
zapalenia mózgu. U 1 dziecka rozpoznano zaburzenie ze spektrum autyzmu. Nie 
stwierdzono związku pomiędzy przewlekłymi schorzeniami neurologicznymi 
a częstością zakażenia C. pneumoniae, potwierdzając obecność patogenu u 2 dzieci z tej 


grupy. 
Odsetek dzieci z chorobami przewlekymi w grupie bez zakażenia C. pneumoniae 
oraz wśród pacjentów zakażonych przedstawiono na rycinie 10. 
Na podstawie przeprowadzonej analizy pod kątem chorób przewlekłych ustalono, 
iż 71 % zakażeń C. pneumoniae występowało u dzieci bez wcześniejszych obciążeń 
zdrowotnych (rycina 11). U jednego pacjenta z grupy Z stwierdzono niedobory 
odporności oraz zaburzenia rozwoju psychoruchowego. 


62
		

/p0063.djvu

			Ryc.IO Odsetek dzieci z chorobami przewlekłymi w grupie pacjentów bez zakażenia 
i zakażonych C.pneumoniae. 


12% 
10% 
8% 
6% 
4% . grupa NZ 
2% . grupa Z 
0% 


rf-'&- 

 


 

lS 

 


 

 


e 
,#
 
;r} 
:04;,. 
o
 

 


# 
o
 
J>-Q 
rf-'&- 

'b .;s. 'łQ # -Q" e ,ji :o o Ryc.ll Odsetek pacjentów z chorobami przewlekłymi w grupie Z. 63

/p0064.djvu

			4.1.5. Wpływ przewlekłego leczenia wziewnymi lekami kortykosteroidowymi 
Nie stwierdzono wpływu przewlekłego stosowania wziewnych leków 
kortykosteroidowych na częstość zakażeń C. pneumoniae. Odsetek dzieci leczonych 
takimi preparatami w grupie dodatniej i ujemnej przedstawiono na rycinie 12. 


Ryc.12 Odsetek dzieci badanych leczonych przewlekle kortykosteroidami 



 
12% 
10% 
8% 
. przewlekłe stosowanie 
6% korty k osteroi d ów 
4% 
2% 
0% 
grupa NZ grupa Z 


4.1.6. Częstość zakażeń Chlamydophila pneumoniae w zależności od pory roku 
Analizowano związek pomiędzy porą roku a częstością zakażeń Chlamydophila 
pneumoniae u dzieci. Ilość oraz odsetek wyników dodatnich i ujemnych 
w poszczególnych miesiącach przedstawiono w tabeli 4. W analizie uwzględniono 
jednak nierównomierną ilość wykonanych badań w poszczególnych miesiącach. Na 
rycinie 13 przedstawiono zależność pomiędzy odsetkiem wyników dodatnich a ilością 
wykonanych oznaczeń. W przypadkach znacznie wyższego odsetka wyników 
dodatnich, uzyskanych w sierpniu i wrześniu, zbiega się to z wyjątkowo niską liczbą 
badań, co przekreśla istotność statystyczną tych zjawisk. W pozostałych miesiącach nie 
stwierdzono znamiennych statystycznie różnic. 


64
		

/p0065.djvu

			Tab.4 Ilość i odsetek wyników dodatnich i ujemnych w poszczególnych miesiącach roku. 


Miesiąc roku Wynik Razem 
uJemny dodatni 
1 18 (100,0%) O (0,0%) 18 (100,0%) 
2 24 (88,9%) 3 (11,1%) 27 (100,0%) 
3 13 (86,7%) 2 (13,3%) 15 (100,0%) 
4 20 (80,0%) 5 (20,0%) 25 (100,0%) 
5 8 (72,7%) 3 (27,3%) 11 (100,0%) 
6 8 (88,9%) 1 (11,1%) 9 (100,0%) 
7 8 (100,0%) O (0,0%) 8 (100,0%) 
8 1 (50,0%) 1 (50,0%) 2 (100,0%) 
9 1 (25,0%) 3 (75,0%) 4 (100,0%) 
10 39 (81,3%) 9(18,8%) 48 (100,0%) 
11 16 (84,2%) 3 (15,8%) 19 (100,0%) 
12 12 (75,0%) 4 (25,0%) 16 (100,0%) 
Razem 168 (83,0%) 34 (17,0%) 202 (100,0%) 


Ryc.13 Zależność pomiędzy odsetkiem wyników dodatnich a ilością wykonanych badań 
w poszczególnych miesiącach roku. 


1 00% 


80% 


60 


c:::::J wyn i k 
ujemny 
_wynik 
dodatni 
-liczba 
badanych 


50 


40 
3= 60% J: 
-o o 

 > 
c: c: 
cu 
> "C 
3= 30 
 

 
(1) cu 
.... .c 
(1) 
U) N 
"C 40% o 
O ::J 
20 


20% 


10 


0% 


o 


2 


3 


4 


5 


6 


7 


8 


9 


10 


11 


12 


Miesiąc badania 


65
		

/p0066.djvu

			4.1.7. Zależność częstości zakażeń Chlamydophila pneumoniae od przebywania 
w placówkach dla dzieci. 
Analizie poddano wpływ przebywania dzieci w dużych zbiorowościach 
tj. żłobek, przedszkole, szkoła na częstość zakażenia C. pneumoniae, nie stwierdzając 
częstszego występowania zakażenia u dzieci uczęszczających do tych placówek (tabela 
5). Nie stwierdzono również aby obecność innych dzieci w środowisku domowym 
(rodzeństwo) wpływała na częstość zakażenia C. pneumoniae. (tabela 6). 


Tab.S Ilość oraz odsetek dzieci w grupie dodatniej i ujemnej uczęszczających do żłobka, 
przedszkola i szkoły. 


Grupa ujemna Grupa dodatnia p 
Cecha liczba dzieci % liczba dzieci % 
101=100% 30=100% 
żłobek 
przedszkole 46 46 9 30 NS 
szkoła 


Tab.6 Ilość oraz odsetek dzieci w grupie dodatniej i ujemnej posiadających rodzeństwo. 


Grupa ujemna Grupa dodatnia 
Cecha % % P 
liczba dzieci 161 = 100% liczba dzieci 34 = 100% 
rodzeństwo 81 50 15 44 NS 


4.2. Przebieg kliniczny zakażenia Chlamydophila pneumoniae 
4.2.1. Postać choroby 
W analizie przebiegu klinicznego zakażenia C. pneumoniae wzięto po uwagę 
postać choroby, uwzględniając w rozpoznaniu: zapalenie płuc, zapalenie oskrzeli, 
zapalenie górnych dróg oddechowych oraz astmę oskrzelową. Zapalenie płuc 
u wszystkich dzieci rozpoznano na podstawie zmian w badaniu radiologicznym. Dzieci 
z tą diagnozą stanowiły najliczniejszą podgrupę wśród włączonych do badania 
pacjentów 69% (n=140). W grupie z rozpoznanym zapaleniem oskrzeli u 97% 
wykonano również badanie radiologiczne płuc, które nie potwierdziło zmian zapalnych. 
Dzieci z zapaleniem oskrzeli stanowiły 22% grupy badanej (n=45). Objawy stanu 
zapalnego tylko w obrębie górnych dróg oddechowych stanowiły kryterium włączenia 
5% badanych pacjentów (n=10). Zaostrzenie astmy oskrzelowej obserwowano u 3% 
dzieci z grupy badanej (n=7). Zakażenie C.pneumoniae potwierdzono u 16% dzieci 


66
		

/p0067.djvu

			z zapaleniem płuc, 22% z zapaleniem oskrzeli, u 20% pacjentów z objawami tylko ze 
strony górnych dróg oddechowych oraz u 14% pacjentów z zaostrzeniem astmy 
oskrzelowej. Proporcje grupy zakażonej do niezakażonej w podgrupach wydzielonych 
na podstawie rozpoznania, ilość dzieci w poszczególnych podgrupach oraz procentowy 
udział podgrup w grupach Z i NZ przedstawiono na rycinie 14 oraz tabeli 7. 


Ryc.14 Ilość dzieci zakażonych oraz bez zakażenia C.pneumoniae w podgrupach 
wydzielonych na podstawie rozpoznania klinicznego. 


100% 
90% 
80% 
70% 
60% 
50% 
40% 
30% 
20% 
10% 
0% 


. grupa NZ 
. grupa Z 


zapalenie płuc 


zapalenie 
osk rzel i 


zapalenie w 
obrębie g.d.o 


zaostrzenie 
astmyo. 


Tab.7 Odsetek dzieci z poszczególnym rozpoznaniem w grupie Z i NZ 


Grupa NZ Grupa Z 
Rozpoznanie liczba dzieci % liczba dzieci % p 
168 = 100% 34 = 100% 
Zapalenie płuc 118 70 22 65 NS 
Zapalenie oskrzeli 35 21 10 29 NS 
Zapalenie g.d.o. 9 5 1 3 NS 
Zaostrzenie a.o. 6 4 1 3 NS 


67
		

/p0068.djvu

			4.2.2. Gorączka 
W analizie uwzględniono wyniki pomiaru temperatury ciała w trakcie pobytu na 
oddziale oraz przed hospitalizacją, na podstawie informacji od rodziców uzyskanych 
w wyniku przeprowadzonego w chwili przyjmowania dziecka do szpitala wywiadu. 
Odsetek dzieci z gorączką w grupie bez zakażenia C. pneumoniae oraz z zakażeniem 
przedstawiono w tabeli 8. 


Tab.S Częstość występowania gorączki w grupie dzieci z zakażeniem C. pneumoniae 
i niezakażonych. 


Grupa NZ Grupa Z 
Cecha % % P 
liczba dzieci 168 = 100% liczba dzieci 34 = 100% 
Gorączka 94 56 17 50 NS 


4.2.3. Czas trwania infekcji przed hospitalizacją 
Czas trwania infekcji przed hospitalizacją ustalano na podstawie wywiadu 
z rodzicami zbieranego w momencie przyjmowania dziecka do szpitala. Dane uzyskano 


, 
od 196 pacjentów, przedstawiono w tabeli 9. Sredni czas trwania infekcji przed 
przyjęciem dziecka do szpitala był dłuższy w przypadku grupy Z. 


Tab.9 Czas trwania infekcji przed hospitalizacją 


Czas trwania (dni) 
n 
średnia mediana . . maksimum SD P 
mInImum 
Grupa NZ 162 7,5 4,0 0,0 120,0 13,3 
Grupa Z 34 9,9 7,0 1,0 60,0 11,4 0,018 


68
		

/p0069.djvu

			4.2.4. Zmiany osłuchowe oraz duszność 
Nie uzyskano istotnych statystycznie różnic w zakresie częstości występowania 
duszności oraz zmian osłuchowych świadczących o obturacji dróg oddechowych. 
Porównanie obu grup w tym zakresie przedstawiono na rycinie 15. W analizie nie 
uwzględniono podgrupy dzieci, u których występowały tylko objawy ze strony górnych 
dróg oddechowych. 


Ryc.tS Odsetek dzieci z objawami duszności oraz obturacją w drogach oddechowych 
w grupie z zakażeniem C. pneumoniae oraz niezakażonej. 


50% 
45% 
40% 
35% 
30% 
25% 
20% 
15% 
10% 
5% 
0% 


NS 


. grupa NZ 
. grupa Z 


duszność 


obturacja 


4.2.5. Zapalenie zatok 
Zapalenie zatok, rozpoznane na podstawie badania radiologicznego, 
występowało istotnie częściej u dzieci z zakażeniem układu oddechowego wywołanym 
innym niż C. pneumoniae czynnikiem. Rozpoznanie to stawiano, jeżeli badanie 
radiologiczne uwidoczniło płyn w zatokach lub ich zacienienie. W grupie dzieci 
z zakażeniem C. pneumoniae u żadnego z pacjentów nie postawiono takiego 
rozpoznania, natomiast w grupie ujemnej zapalenie zatok rozpoznano u 20 pacjentów. 
Wyniki przedstawiono w tabeli 10. 


69
		

/p0070.djvu

			4.2.6. Zapalenie ucha środkowego 
Nie wykazano istotnych różnic pomiędzy częstością występowania zapalenia 
ucha środkowego u dzieci z zakażeniem C.pneumoniae i bez, mimo, iż wśród pacjentów 
z grupy NZ u 7 dzieci postawiono takie rozpoznanie, natomiast w grupie Z nie 
rozpoznano zapalenia ucha środkowego u żadnego z dzieci (tabela 10). 


Tab.IO Zapalenia zatok i ucha środkowego w grupie Z i NZ. 


Grupa ujemna Grupa dodatnia 
Ilość dzieci % Ilość dzieci % p 
zapalenie zatok 20 12 O O 0,034 
zapalenie ucha 7 4 O O NS 
środkowego 


4.2.7. Zmiany radiologiczne 
Analizując zmiany radiologiczne w badaniu przeglądowym klatki piersiowej 
dokonano porównania w zakresie następujących cech: lite zmian zapalne obejmujące 
cały płat płuca, lite zmiany w obrębie jednego segmentu, zmiany odoskrzelowe, 
zmIany o charakterze śródmiąższowym, wykładniki zapalenia opłucnej, 
wieloogniskowe zmiany obustronne. Najczęściej, zarówno w grupie Z jak i NZ, 
występowały zmiany o charakterze odoskrzelowym, odpowiednio w 81 % i 79% dzieci, 
bez istotnych różnic między grupami. Nie stwierdzono również istotnych różnic 
w częstości występowania pozostałych wymienionych cech w badaniu radiologicznym 
pomiędzy grupami. Częstość ich występowania przedstawiono na rycinie 16. 


70
		

/p0071.djvu

			Ryc.16 Częstość występowania poszczególnych zmian w obrazie radiologicznym w grupie 
NZ i grupie Z. 


90% 
80% 
70% 
60% 
50% 
40% 
30% . grupa NZ 
20% . grupa Z 
10% 
0% 


: 4 
4 III 4 
I " 
I 


ił e .;ł.e .;ł.e 
,0 o o 
re 

 j!:: 

 q'" !li 

o
 

-\ 
 
er 
 
c:y- 


 1; 
",-t::t 
#
 

 


o
e rv
 {::t
 
::.

 o
 ,:,

 
J::,
 
e 
 
I;
- 
e; 
 

 '"? Si" 
"li 
.

 
 1;
 

 


4.2.8. Badania laboratoryjne 
4.2.8.1. Białko C-reaktywne (CRP) 


Stwierdzono istotne różnice w zakresie stężenia w surowicy biochemicznego 
wykładnika procesu zapalnego, białka C-reaktywnego, ocenianego w pierwszej dobie 
hospitalizacji. Zarówno ilość dzieci z CRP powyżej normy jak i średnia wartość CRP 
w grupie z potwierdzonym zakażeniem C.pneumoniae były niższe w porównaniu 
z grupą niezakażoną. Liczba oraz odsetek dzieci z wynikiem CRP powyżej normy 
w obu grupach przedstawiono w tabeli 11. W grupie NZ liczba dzieci poddana analizie 
w zakresie tego parametru wynosi n=165, ze względu na brak wyniku CRP w pierwszej 


, 
dobie hospitalizacji u 3 pacjentów. Srednią wartość CRP w obu grupach przedstawiono 
w tabeli 12. 


Tab.ll Ilośc oraz odsetek dzieci z CRP powyżej normy w grupie NZ i grupie Z. 


Grupa NZ (n=165) Grupa Z (n=34) 
Ilość dzieci z odsetek dzieci z Ilość dzieci z odsetek dzieci z p 
CRP powyżej CRP w powyżej CRP w powyżej CRP powyżej 
normy normy (%) normy normy (%) 
102 62 14 41 0,027 


71
		

/p0072.djvu

			Tab.12 Średnia wartość CRP w grupie NZ i grupie Z. 


, 
Srednia Mediana Minimum Maksimum SD p 
CRP 
(mgli) 
Grupa NZ (n=165) 28,9 9,0 1,0 370,0 52,1 
Grupa Z (n=34) 14,1 5,0 1,0 82,0 20,3 0,034 


4.2.8.2. Obecność swoistych przeciwciał przeciw Chlamydophila pneumoniae 
Oznaczenie swoistych przeciwciał w klasie immunoglobulin A, M i G 


, 
wykonano u 28 pacjentów z grupy z potwierdzonym zakażeniem. Sredni czas od 
początku infekcji do momentu pobrania krwi wynosił 16 dni (SD + 12), minimalny 3 dni, 
maksymalny 60 dni. Ilość dzieci z dodatnimi wynikami przeciwciał w poszczególnych 
klasach przedstawiono w tabeli 13. 


Tab.13 Ilość dzieci z dodatnim wynikiem przeciwciał przeciw C. pneumoniae 
w poszczególnych klasach. 


Klasa immunoglobulin IgA IgM IgG 
Ilość dzieci z wynikiem 
dodatnim O O 1 
(n=28) 


Dodatni wynik przeciwciał w klasie IgG uzyskano w surowicy pobranej 28 dnia od 
początku infekcji dróg oddechowych, od sześciomiesięcznego dziecka. 


4.2.9. Objawy spoza układu oddechowego 
W analizie obrazu klinicznego zakażenia Chlamydophila pneumonlae oraz 
w porównaniu przebiegu klinicznego infekcji dróg oddechowych grupy zakażonej 
i niezakażonej uwzględniono objawy patologiczne ze strony układów innych niż 
oddechowy. Poniżej podano częstość występowania wybranych objawów. 


4.2.9.1. Biegunka 
Nie stwierdzono istotnych statystycznie różnic pomiędzy grupami NZ i Z 
w częstości występowania objawów ze strony przewodu pokarmowego pod postacią 
biegunki. Z analizy wyłączono dzieci, u których zidentyfikowano czynnik infekcyjny 
typowy dla stanu zapalnego w obrębie przewodu pokarmowego (Rotawirusy, bakterie 
z rodzaju Salmonella). W grupie NZ i grupie Z biegunka występowała odpowiednio 
u 20% (n=34) i 24% (n=8) dzieci. 


72
		

/p0073.djvu

			4.2.9.2. Małopłytkowość 
Ostrą małopłytkowość stwierdzono u 1 dziecka zakażonego C. pneumonlae 
(3%). Nie stwierdzono natomiast tego objawu u żadnego z pacjentów w grupie 
niezakażonej . 


4.2.9.3. Zapalenie osierdzia 
Zapalenie osierdzia rozpoznano na podstawie wykonanego badania 
echokardiograficznego u 1 pacjenta z grupy Z (3%). Stanu zapalnego mięśnia 
sercowego oraz wsierdzia nie rozpoznano u żadnego pacjenta z grupy badanej. Nie 
potwierdzono również zapalenia osierdzia u żadnego pacjenta z grupy NZ. 


4.2.9.4. Posocznica 
W grupie dzieci włączonych do badania posocznIcę rozpoznano u jednego 
pacjenta, bez zakażenia C. pneumoniae Rozpoznania tego nie postawiono w przypadku 
żadnego z pacjentów z grupy dodatniej. 


4.2.9.5. Objawy ze strony układu nerwowego 
Niepokojących objawów neurologicznych nie obserwowano u żadnego z dzieci 
z grupy dodatniej. W grupie ujemnej u 1 pacjenta postawiono rozpoznanie ropnego 
zapalenia opon mózgowo-rdzeniowych, u 1 dziecka obserwowano drgawki gorączkowe 
w przebiegu infekcji dróg oddechowych i zakażenia Rotawirusami. 


73
		

/p0074.djvu

			4.3. Leczenie 


4.3.1. Leczenie celowane w trakcie hospitalizacji 
Leczenie antybiotykami potencjalnie skutecznymi w stosunku do C. pneumoniae 
stosowano u dzieci z potwierdzonym zakażeniem tylko ze wskazań klinicznych. 
U wszystkich pacjentów, u których podjęto leczenie celowane, stosowano antybiotyki 
makrolidowe- klarytromycynę, roksytromycynę lub azytromycynę. W przypadku 
pierwszych dwóch stosowano kurację 10-14 dniową, natomiast azytromycyna 
podawana była przez 3 do 5 dni, w dawce zgodnej z zaleceniami producenta. Część 
dzieci zakażonych C. pneumoniae w momencie otrzymania wyniku badania PCR nie 
wymagała włączenia kolejnego antybiotyku. Makrolidów nie stosowano jako 
antybiotyku pierwszego rzutu. U dzieci, u których nie podjęto leczenia zakażenia 
C.pneumoniae uzyskano ustąpienie objawów choroby, a w przypadku pacjentów 
z zapaleniem płuc, u których podjęto decyzję o kontrolnym badaniu radiologicznym 
płuc, również zmian zapalnych obserwowanych na zdjęciu. Antybiotyk makrolidowy 
zastosowano u 14 z 34 dzieci (podgrupa L), w przypadku 20 uznano, iż nie ma potrzeby 
zmiany terapii ani dołączania kolejnego leku (podgrupa NL). W podgrupie dzieci 
nieleczonych, 80% (n=16) to dzieci z rozpoznanym zapaleniem płuc, 20% (n=4) 
pacjenci z zapaleniem oskrzeli. Odsetek dzieci leczonych w sposób celowany 
i nieleczonych przedstawiono na rycinie 17. 


Ryc.17 Odsetek dzieci leczonych w sposób celowany oraz bez leczenia w grupie 
z zakażeniem C. pneumoniae. 


74
		

/p0075.djvu

			4.3.2. Leczenie celowane po okresie hospitalizacji 
Dzieciom z potwierdzonym zakażeniem C. pneumonlae, które w trakcie 
hospitalizacji nie otrzymywały antybiotyku makrolidowego, zalecono zastosowanie 
takiej terapii w przypadku kolejnej infekcji dróg oddechowych. Dane dotyczące 
leczenia po okresie hospitalizacji uzyskano od dzieci, które zgłosiły się na wizytę 
kontrolną (n=23). Na rycinie 18 przedstawiono odsetek dzieci leczonych i nieleczonych 
z uwzględnieniem hospitalizacji oraz okresu późniejszego - od początku infekcji 
będącej przyczyną włączenia do badania do czasu wizyty kontrolnej, która miała 
miejsce od 7 do 20 miesięcy od hospitalizacji. Spośród 23-osobowej grupy 7 dzieci nie 
otrzymało leczenia celowanego do momentu kontrolnego wymazu z gardła, pobranego 
w okresie zdrowia. 


Ryc.tS Odsetek dzieci leczonych i nieleczonych w sposób celowany od włączenia do 
badania do kontrolnego wymazu z gardła w grupie z potwierdzonym zakażeniem 
C. pneumoniae. 


75
		

/p0076.djvu

			4.4. Badanie kontrolne 


4.4.1. Oznaczenie Chlamydophila pneumoniae w wymazie z gardła 
W kontrolnym wymazie z gardła, wykonanym w okresie zdrowia u pacjentów 
uprzednio zakażonych C. pneumoniae, spośród 23 badanych dzieci, wynik ujemny 
uzyskano u 22, u jednego z dzieci potwierdzono ponownie zakażenie. Dane procentowe 
przedstawiono na rycinie 19. 


Ryc.19 Odsetek pacjentów z dodatnim i ujemnym wynikiem kontrolnego badania 
w kierunku C. pneumoniae. 


4.4.2. Związek pomiędzy leczeniem celowanym a eliminacją Chlamydophila 
pneumoniae z dróg oddechowych 
U wszystkich pacjentów, u których zastosowano leczenie antybiotykiem 
makrolidowym (n=16) doszło do eliminacji C. pneumoniae z dróg oddechowych. 
W grupie pacjentów nieleczonych (n=7) 86% tj. 6 dzieci wyeliminowało patogen. 
Wyniki przedstawiono na rycinach 20 i 21. 


76
		

/p0077.djvu

			Ryc.20 Odsetek pacjentów leczonych i nieleczonych, którzy wyeliminowali C. pneumoniae 
z dróg oddechowych. 


100% 


. ujemny Vl/Ymaz kontrolny 


Ryc.2I Ilość pacjentów w grupie leczonej i bez leczenia celowanego z dodatnim i ujemnym 
wynikiem kontrolnego wymazu z gardła. 


95% 


90% 


85% 


80% 


75% 


pogdrupa l 


podgrupa Nl 


16 
14 
12 
10 
8 
6 
4 
2 
O 


podgrupa l 


podgrupa Nl 


. dodatni Vl/Ymaz kontrolny 
. ujemny UJYmaz kontrolny 


77
		

/p0078.djvu

			4.4.3. Analiza przebiegu choroby dziecka z dodatnim wynikiem kontrolnym 
· w momencie włączenie do badania dziecko w naj młodszej grupie wiekowej 
(11 miesięcy) 
· rozpoznanie kliniczne: zapalenie płuc 
· obecność duszności i obturacji dróg oddechowych 
· w wywiadzie nawracające infekcje dolnych dróg oddechowych 
· brak przewlekłych chorób towarzyszących 
· nie stwierdzono zaburzeń odporności w zakresie głównych klas immunoglobulin 
(badania dwukrotne) 
· przewlekłe stosowanie WZIewne leków sterydowych (4 mIeSIące przed 
badaniem) 
· dziecko uczęszczało do żłobka (zarówno w momencie włączenia do badani, jak 
i w momencie badania kontrolnego) 
· kontrolny wymaz pobrano 17 miesięcy po pierwszym badaniu 
· po zakończeniu hospitalizacji nie obserwowano nawracających infekcji dróg 
oddechowych 
· opiekujący się dzieckiem lekarz pulmonolog zdecydował o zakończeniu leczenia 
wziewnymi preparatami sterydowymi (przed kontrolnym wymazem) 


78
		

/p0079.djvu

			4.5. Analiza 


mikrobiologiczna, 


immunologiczna 


oraz 


ocena 


wykładników gospodarki lipidowej 


4.5.1. Ocena występowania DNA Chlamydophila pneumoniae 
W diagnostyce mikrobiologicznej zakażeń C. pneumoniae zastosowano metodę 
biologii molekularnej (nested-PCR) i na podstawie analizy na żelu agarozowym (Ryc. 
22) obecność DNA C. pneumoniae stwierdzono u 34 (-17%) pacjentów w grupie dzieci 
chorych (n=202) w pierwszym terminie badania. Wyniki przedstawiono w tabeli 14. 


Tab.14 Zestawienie liczbowe uzyskanych wyników oznaczeń DNA C. pneumoniae w grupie 
dzieci chorych. 


Oznaczenia DNA C. pneumoniae 


Liczba (% ) chorych dzieci 


C. pneumoniae (+) 


34 (16,8%) 


C. pneumoniae (-) 


168 (83,2%) 


W przypadku przeprowadzonych kontrolnych oznaczeń DNA C. pneumoniae u dzieci 
ze stwierdzonym zakażeniem C. pneumoniae w ostrym okresie choroby, obecność DNA 
C. pneumoniae w II terminie badania stwierdzono tylko u jednego dziecka. 


Ryc.22 Wyniki otrzymanych produktów reamplifikacji DNA C. pneumoniae (147 bp), 
wybranych prób badanych, metodą nested-PCR na 2% żelu agarozowym 
barwionym bromkiem etydyny. Pozycje na żelu: ścieżka l - wzorzec molekularny 
100-500 bp (DNA Gdańsk II), 2 - kontrola dodatnia C. pneumoniae, 3 - kontrola 
ujemna C. pneumoniae, ścieżki 4 - 12 dodatnie próby badane. 


79
		

/p0080.djvu

			4.5.2. Ocena poziomu cytokin: IFN-y, IL-1p, TNF-a i IL-10 


4.5.2.1. Ocena poziomu cytokin: IFN-y, IL-1p, TNF-a i IL-10 w grupach 
kontrolnych 
W surowicy krwi dzieci zdrowych - grupa 1 K (grupa kontrolna dzieci < 3 roku 
życia; n=12) - uzyskane średnie wartości badanych cytokin wynosiły dla IFN-y: 0,09 + 
1,34 pg/ml, dla IL-1
: 0,11 + 0,14 pg/ml, dla TNF-a: 0,39 + 0,41 pg/ml oraz dla IL-10: 
0,42 + 0,36 pg/ml. 
W grupie 2K (grupa kontrolna dzieci zdrowych> 3 roku życia; n=15) uzyskane 
średnie wartości badanych cytokin w surowicach krwi wynosiły dla IFN-y: 0,08 + 1,35 
pg/ml, dla IL-1
: 0,11 + 0,16 pg/ml, dla TNF-a: 0,42 + 0,59 pg/ml oraz dla IL-10: 0,85 
+ 1,17 pg/ml. (Tab.15, Ryc.23-24) 


Tab.IS Zestawienie wyników badanych cytokin (IFN-y, IŁ-Ip, TNF-a i IŁ-lO) w grupach 
dzieci zdrowych: grupa IK i grupa 2K. 


Oznaczana 
cytokina 


Grupa kontrolna 1K Grupa kontrolna 2K 
(n = 12) (n = 15) 


IFN -y 


0,09 + 1,34 pg/ml 


0,08 + 1,35 pg/ml 


IL-1p 


0,11 + 0,14 p g/mI 


0,11 + 0,16 p g/mI 


TNF -a 


0,39 + 0,41 pg/ml 


0,42 + 0,59 pg/ml 


IL-10 


0,42 + 0,36 pg/ml 


0,85 + 1,17 pg/ml 


80
		

/p0081.djvu

			Ryc.23 Graficzne przedstawienie średnich wartości poziomów badanych cytokin w grupie 
dzieci zdrowych < 3 roku życia (grupa kontrolna lK). 


pg/ml 
0,45 
0,40 
0,35 
0.30 
0,25 
0,20 
0,15 
0,10 
0,05 
0,00 
IFN-y 


IL-1 II 


TNF-a 


IL-10 


Ryc.24 Graficzne przedstawienie średnich wartości poziomów badanych cytokin w grupie 
dzieci zdrowych> 3 roku życia (grupa kontrolna 2K). 


pg/ml 
0,90 
0,80 
0,70 
0,60 
0.50 
0,40 
0.30 
0,20 
0,10 
0,00 
IFN-y 


IL-1 II 


TNF-a 


IL-10 


81
		

/p0082.djvu

			4.5.2.2. Ocena poziomu cytokin: IFN-y, IL-1p, TNF-a i IL-10 w grupach dzieci 
chorych 
W surowicach krwi dzieci chorych z grupy 1 « 3 roku życia; n=20) w I terminie 
badania (ostrym okresie choroby) średnie wartości oznaczanych cytokin wynosiły dla 
IFN -y: 0,32 + 0,29 pg/ml, dla IL-1
: 0,83 + 0,38 pg/ml, dla TNF-a: 1,05 + 0,39 pg/ml 
oraz dla IL-10: 5,36 + 2,28 pg/ml. W II terminie badania (okresie zdrowienia) średnie 
wartości oznaczanych cytokin wynosiły dla IFN-y: 1,78 + 1,12 pg/ml, dla IL-1
: 0,27 + 
0,29 pg/ml, dla TNF-a: 3,15 + 1,14 pg/ml oraz dla IL-10: 0,65 + 0,7 pg/ml. 
W grupie 2 (dzieci chore> 3 roku życia; n=14) w I terminie badania średnie 
wartości oznaczanych w surowicy krwi cytokin wynosiły dla IFN -y: 0,31 + 0,28 pg/ml, 
dla IL-1
: 1,18 + 0,54 pg/ml, dla TNF-a: 1,06 + 0,50 pg/ml oraz dla IL-10: 6,49 + 2,50 
pg/ml. W II terminie badania średnie wartości oznaczanych cytokin wynosiły dla IFN-y: 
2,02 + 1,21 pg/ml, dla IL-1
: 0,21 + 0,20 pg/ml, dla TNF-a: 3,18 + 0,48 pg/ml oraz dla 
IL-10: 0,92 + 0,78 pg/ml. 
Wyniki przeprowadzonych oznaczeń cytokin: IFN-y, IL-1
, TNF-a i IL-10, 
w dwóch grupach wiekowych dzieci chorych (grupie 1 i grupie 2) oraz w dwóch 
terminach badania (termin I - ostry okres choroby i termin II - okres zdrowienia) 
w porównaniu z grupami kontrolnymi (grupa 1K i grupa 2K) przedstawiono w tabelach 
16-17 oraz na rycinach 25-30. 


Tab.16 Zestawienie średnich wyników badanych cytokin (IFN-y, IŁ-Ip, TNF-a i IŁ-lO) 
w grupie l oraz grupie dzieci zdrowych (grupa kontrolna IK) w dwóch terminach 
badania. 


Grupa 1 (n = 20) 


Oznaczana 
cytokina 


grupa kontrolna 1K 
(n = 12) 


termin 1 


termin 2 


IFN -y 


0,32 + 0,29 pg/ml 1,78 + 1,12 pg/ml * 0,09 + 1,34 pg/ml 


IL-1p 


0,83 + 0,38 pg/ml * 0,27 + 0,29 pg/ml 0,11 + 0,14 pg/ml 


TNF -a 


1,05 + 0,39 pg/ml 3,15 + 1,14 pg/ml * 0,39 + 0,41 pg/ml 


IL-10 


5,36 + 2,28 pg/ml * 0,65 + 0,7 pg/ml 


0,42 + 0,36 pg/ml 


* oznaczono różnicę statystycznie istotną względem grupy kontrolnej (p	
			

/p0083.djvu

			Ryc.25 Graficzne przedstawienie średnich wartości poziomów badanych cytokin w grupie 
dzieci chorych < 3 roku życia (grupa l) w ostrym okresie choroby (I termin 
badania). 
pg/ml 


6,00 


5,00 


4,00 


3,00 


2,00 


1,00 


0,00 


IFN-y 


IL-1 P 


1NF-a 


IL-10 


Ryc.26 Graficzne przedstawienie średnich wartości poziomów badanych cytokin w grupie 
dzieci chorych < 3 roku życia (grupa l) w okresie zdrowienia (II termin badania). 
pg/ml 


3.50 
3,00 
2.50 
2,00 
1.50 
1,00 
0.50 
0,00 
IFN-y 


IL-1 II 


TNF-a 


IL-10 


83
		

/p0084.djvu

			Ryc.27 Zestawienie wyników badanych cytokin (IFN-y, IŁ-Ip, TNF-a i IŁ-lO) w grupie l 
oraz grupie dzieci zdrowych (grupa kontrolna IK) w dwóch terminach badania. 


Tab.17 Zestawienie średnich wyników badanych cytokin (IFN-y, IŁ-Ip, TNF-a i IŁ-lO) 
w grupie 2 oraz grupie dzieci zdrowych (grupa kontrolna 2K) w dwóch terminach 
badania. 


Grupa 2 (n = 14) 


Oznaczana 
cytokina 


grupa kontrolna 2K 
(n = 15) 


termin 1 


termin 2 


IFN -1 


0,31 + 0,28 pg/ml 2,02 + 1,21 pg/ml * 


0,08 + 1,35 pg/ml 


IL-1p 


1,18 + 0,54 pg/ml * 0,21 + 0,20 pg/ml 


0,11 + 0,16 p g/mI 


TNF -u 


1,06 + 0,50 pg/ml 3,18 + 0,48 pg/ml * 


0,42 + 0,59 pg/ml 


IL-10 


6,49 + 2,50 pg/ml * 0,92 + 0,78 pg/ml 


0,85 + 1,17 pg/ml 


* oznaczono różnicę statystycznie istotną względem grupy kontrolnej (p	
			

/p0085.djvu

			Ryc.28 Graficzne przedstawienie średnich wartości poziomów badanych cytokin w grupie 
dzieci chorych >3 roku życia (grupa 2) w ostrym okresie choroby (I termin 
badania). 
pg/ml 


7,00 
6,00 
5,00 
4,00 
3,00 
2,00 
1,00 
0,00 
IFN-y 


IL-1 P 


1NF-a 


IL-10 


Ryc.29 Graficzne przedstawienie średnich wartości poziomów badanych cytokin w grupie 
dzieci chorych >3 roku życia (grupa 2) w okresie zdrowienia (II termin badania). 


pg/ml 
3.50 
3,00 
2.50 
2,00 
1.50 
1,00 
0.50 
0,00 
IFN-y 


IL-1 II 


THF-a 


IL-10 


85
		

/p0086.djvu

			Ryc.30 Zestawienie wyników badanych cytokin (IFN-y, IŁ-Ip, TNF-a i IŁ-lO) w grupie 2 
oraz grupie dzieci zdrowych (grupa kontrolna 2K) w dwóch terminach badania. 


Analizując uzyskane wyniki w grupIe dzieci < 3 roku życia (grupa 1) 
stwierdzono, że stężenia IFN-y oraz TNF-a nie różniły się istotnie statystycznie 
w porównaniu z grupą kontrolną 1K (p>0,05) w pierwszym terminie badania (ostrym 
okresie choroby). W pierwszym terminie badania wyniki oznaczeń dla IL-1 
 
charakteryzowały się umiarkowanym wzrostem. Natomiast w przypadku IL-10 
stwierdzono znaczne zwiększenie poziomu w odniesieniu do grupy dzieci zdrowych 
(grupy kontrolnej 1K). W okresie zdrowienia (II termin badania) stężenia IL-1
 i IL-10 
nie różniły się istotnie statystycznie w porównaniu z grupą kontrolną 1K (p>0,05). 
Wyniki oznaczeń dla poziomów IFN-y oraz TNF-a różniły się istotnie statystycznie 
wobec grupy 1 K. 
W przypadku dzieci >3 roku życia (grupa 2) wyniki oznaczanych cytokin nie 
odbiegały zasadniczo od wyników dla dzieci z grupy 1. Stężenia IFN-y oraz TNF-a nie 
różniły się istotnie statystycznie w porównaniu z grupą kontrolną 2K (p>0,05) 
w pierwszym terminie badania. Poziom IL-1 
 charakteryzował się umiarkowanym 
wzrostem. Jednak stwierdzono znaczne zwiększenie poziomu IL-10 w ostrym okresie 
choroby w odniesieniu do grupy dzieci zdrowych (grupy kontrolnej 2K). W II terminie 


86
		

/p0087.djvu

			badania stężenia IL-1 
 i IL-10 nIe różniły się istotnie statystycznie w porównaniu 
z grupą kontrolną 2K (p>0,05). Wyniki oznaczanych stężeń IFN-y oraz TNF-a różniły 
się istotnie statystycznie względem grupy 2K. 
Wartości średnich poziomów cytokin przedstawiono na rycinach 31-34, 
natomiast poziomy istotności statystycznej w analizie stężenia cytokin w surowicach 
chorych dzieci z zakażeniem C. pneumoniae prezentują tabele 18 i 19. 
W przypadku dziecka z potwierdzonym zakażeniem C. pneumoniae również 
w II terminie badania (okresie zdrowienia) oznaczenia badanych cytokin prezentowały 
się następująco: w pierwszym terminie badania poziomy IFN-y, TNF-a, IL-1
 były 
obniżone, dla IL-10 stwierdzono wzrost. W drugim terminie badania zaobserwowano 
wyraźny wzrost stężenia cytokiny IL-1
, natomiast stężenia pozostałych cytokin były 
obniżone. 


Tab.1S Zestawienie poziomów istotności statystycznej w analizie stężenia cytokin (IFN-y, IŁ-lp, 
TNF-a i IŁ-lO) w surowicach chorych dzieci w grupie 1, w dwóch terminach badania 
oraz w grupie dzieci zdrowych (grupa lK). 


Badane cytokiny 


IFN -1 


IL-1p 


TNF -u 


IL-10 


Badane dzieci 


poziom istotności różnic między grupami 


termin l/termin 2 


pO,05 


pO,05 


pO,05 


pO,05 


* oznaczono różnicę statystycznie istotną względem grupy kontrolnej (p	
			

/p0088.djvu

			Tab.19 Zestawienie poziomów istotności statystycznej w analizie stężenia cytokin (IFN-y, IŁ-Ip, 
TNF-a i IŁ-lO) w surowicach chorych dzieci w grupie 2, w dwóch terminach badania 
oraz w grupie dzieci zdrowych (grupa 2K). 


Badane cytokiny 


IFN -1 


IL-1p 


TNF -u 


IL-10 


Badane dzieci 


poziom istotności różnic między grupami 


termin l/termin 2 


pO,05 


pO,05 


pO,05 


pO,05 


* oznaczono różnicę statystycznie istotną względem grupy kontrolnej (p 	
			

/p0089.djvu

			Ryc.32 Graficzne przedstawienie średnich wartości poziomów IL-lp w badanych grupach dzieci 
chorych w dwóch terminach badania oraz w grupach dzieci zdrowych. 


Pflml 
1,20 


1))0 


IL-lp 



 


0)j0 



40 


0,20 


opo 


Termin 1 Termin 2 GirqJa 
Kontrol na 
Grupa 1 II Grupa lK I 


Termin 1 Termin 2 GirqJa 
Kontrol na 
Grupa 2 II Grupa 2K I 


Ryc.33 Graficzne przedstawienie średnich wartości poziomów TNF -a w badanych grupach dzieci 
w dwóch terminach badania oraz w grupach dzieci zdrowych. 


Pflml 
3JjO 


3))0 


lN F-a. 


2JiO 


2)XJ 


1JjO 


1))0 


0Jj0 


opo 


Termin 1 Termin 2 GirqJa 
Kontrol na 


Termin 1 Termin 2 GirqJa 
Kontrol na 


Grupa 1 


II Grupa lK I 


Grupa 2 


II Grupa 2K I 


89
		

/p0090.djvu

			Ryc.34 Graficzne przedstawienie średnich wartości poziomów IŁ-lO w badanych grupach dzieci 
dwóch terminach badania oraz w grupach dzieci zdrowych. 
Pflml 
1
 1
10 


6,00 


5))0 


4
 


3))0 


2J)O 


1
 


opo 


Termin 1 Termin 2 GirqJa 
Kontrol na 


Termin 1 Termin 2 GirqJa 
Kontrol na 


Grupa 1 


II Grupa lK I 


Grupa 2 


II Grupa1K I 


4.5.3. Wyniki oznaczeń wykładników gospodarki lipidowej 
Wartości wykładników gospodarki lipidowej oznaczono w surowicach dzieci 
chorych, ze stwierdzonym zakażeniem C. pneumoniae, >2 roku życia (n=16) oraz 
w grupie dzieci zdrowych (n=12). W analizie wyników oceny wykładników gospodarki 
lipidowej, z uwagi na indywidualną zmienność biologiczną, nie uwzględniono dzieci do 
2 roku życia. Wartości referencyjne dla poszczególnych wykładników gospodarki 
lipidowej prezentują się następująco: dla cholesterolu całkowitego <200 mg/dl, dla 
frakcji LDL <130 mg/dl, dla frakcji HDL >35 mg/dl, a dla TG <150 mg/dl. W grupie 
dzieci chorych średnia wartość cholesterolu całkowitego była równa 153,63 + 32,22 
mg/dl, dla frakcji HDL: 51,88 + 11,55 mg/dl, dla LDL: 79,10 + 31,80 mg/dl, a dla 
tri glicerydów (TG): 117,19 + 13,84 mg/dl. Wartości oznaczonych wykładników, 
zarówno w przypadku grupy dzieci chorych, jak i zdrowych pozostawały w zakresie 


, 
wartości referencyjnych. Srednie wartości poszczególnych wykładników gospodarki 
lipidowej w grupie dzieci chorych i w grupie dzieci zdrowych nie różniły się istotnie 
statystycznie (p>0,05). Otrzymane wyniki prezentuje tabela 20 oraz rycina 35. 


90
		

/p0091.djvu

			Tab.20 Zestawienie wyników badanych wykładników gospodarki lipidowej w grupie dzieci 
chorych w ostrym okresie choroby oraz w grupie dzieci zdrowych. 


Oznaczany 
wykładnik 


Grupa dzieci chorych 
(n = 16) 


Grupa kontrolna 
(n = 12) 


Wartości 
referencyjne 


Cholesterol całkowity 153,63 :t 32,22 mg/dl 156,50:t 19,67 mg/dl < 200 mg/dl 
HDL 51,88:t 11,55 mg/dl 46,62 :t 7,89 mg/dl > 35 mg/dl 
LDL 79,10:t 31,80 mg/dl 84,72:t 19,59 mg/dl < 130 mg/dl 
TG 117,19:t 13,84 mg/dl 121,65:t 16,15 mg/dl < 150 mg/dl 


Ryc.35 Graficzne przedstawienie średnich wartości wykładników gospodarki lipidowej 
w grupie dzieci chorych w ostrym okresie choroby oraz grupie dzieci zdrowych. 


mg/dl 


160..00 
140..00 
120..00 
100..00 
80..00 
60..00 
40..00 
20..00 
0..00 


.Grupa dziI!ci choIych 


.Grupa dziI!ci ..aII.............rch 


Cholesterol 
caImwity 


HOL 


L.DL 


TG 


91
		

/p0092.djvu

			5. DYSKUSJA 


Badania nad rolą Chlamydophila pneumoniae w etiologii ostrych chorób układu 
oddechowego toczą się od lat osiemdziesiątych XX wieku, kiedy to po raz pierwszy 
patogen został wyizolowany z dróg oddechowych. Analiza literatury wskazuje, 
iż dane dotyczące epidemiologii zakażeń C. pneumoniae nie są jednoznaczne. 
Początkowo uważano, że drobnoustrój wywołuje stan zapalny w drogach oddechowych 
przede wszystkim u dzieci w wieku szkolnym [4, 78, 112]. Dzięki zastosowaniu technik 
molekularnych stwierdzono jednak, iż zakażenie tym patogenem występuje często 
u dzieci poniżej 5 lat, w tym także u niemowląt [113, 123, 151]. Badania 
seroprewalencji wykazały, iż ponad połowa populacji przechodzi infekcje 
C. pneumoniae, niejednokrotnie o przebiegu bezobjawowym [84, 102]. Pojawia się 
również coraz więcej informacji o możliwych poważnych konsekwencjach zakażenia 
przewlekłego pod postacią zmian miażdżycowych w naczyniach tętniczych, schorzeń 
układu nerwowego takich jak choroba Alzheimera czy stwardnienie rozsiane [60, 77, 
84, 179]. Istnieją też doniesienia na temat infekcji o ciężkim przebiegu, ze zmianami 
wielonarządowymi oraz o związku zakażenia C. pneumoniae z astmą oskrzelową [29, 
33, 74]. Wobec tych danych uzasadnione wydaje się podjęcie badań nad etiologią, 
przebiegiem zakażenia oraz zdolnością do wywoływania nieswoistej reakcji zapalnej, 
która może mieć wpływ na patomechanizm zarówno ostrych jak i przewlekłych stanów 
wywołanych przez C. pneumoniae. 
Spośród 202 dzieci w wieku od 2 miesięcy do 16 lat, przyjętych do szpitala 
z powodu stanu zapalnego w obrębie układu oddechowego, zakażenie Chlamydophila 
pneumoniae, na podstawie badania wymazu z gardła przy użyciu metody nested-PCR, 
stwierdzono u 34 dzieci, co stanowi blisko 17% badanych. Metodę biologii 
molekularnej PCR uważa się za szybką i czułą technikę do wykrywania obecności DNA 
C. pneumoniae w materiale pacjenta [16,133,83,160,170]. 
Podobne dane, dotyczące częstości zakażeń C. pneumoniae, uzyskali w swoim 
badaniu Normann i wsp., którzy zakażenie potwierdzili u 16%, spośród 360 szwedzkich 
dzieci, które zgłosiły się do szpitalnej izby przyjęć z powodu infekcji dróg 
oddechowych. Dane europejskie pokazują, iż zakażenie C. pneumoniae, potwierdzone 
metodą PCR, ma miejsce u około 10% dzieci z infekcją dróg oddechowych, 
wymagających leczenia szpitalnego (Norman i wsp. 11 %, Schmidt i wsp. 9%) [123, 
151]. W przypadku dzieci leczonych w warunkach ambulatoryjnych występowanie 


92
		

/p0093.djvu

			zakażenia C. pneumonlae potwierdzano częściej, w badaniu Normanna i Falck 
odpowiednio u 21 % i 45% chorych [46, 53, 123]. W interpretacji rozbieżności 
pomiędzy uzyskanym w analizowanym badaniu odsetkiem zakażonych dzieci, 
a wynikami Falcka i wsp., należy uwzględnić możliwość cyklicznego nasilenia 
zachorowań wywołanych tym patogenem [165]. 
Należy zauważyć, iż ustalona niniejszej pracy częstość zakażeń C. pneumoniae 
u dzieci hospitalizowanych, nie odbiega od danych uzyskanych w badaniu szwedzkim, 
dotyczących pacjentów z izby przyjęć, a na nieco wyższy odsetek potwierdzonych 
zakażeń w stosunku do pacjentów w innych krajach europejskich mogą mieć wpływ 
czynniki ogrywające istotną rolę przy podejmowaniu decyzji o hospitalizacji. Wśród 
tych ostatnich należy wymienić warunki socjalne, dostęp do badań diagnostycznych 
w lecznictwie ambulatoryjnym czy obecność szpitalnych oddziałów ratunkowych. 
Częstość nosicielstwa C. pneumoniae, ustalona na podstawie badania wymazów 
z gardła pobranych od 60 zdrowych dzieci, wynosiła w analizowanym badaniu 3%. 
Dane te są zgodne z uzyskanymi przez innych badaczy, którzy wykazali nosicielstwo 
C. pneumoniae u 1,5%-6% zdrowych osób, zarówno dzieci jak i dorosłych [47,48, 53, 
84]. 


Wykorzystując do diagnostyki mikrobiologicznej wymaz z gardła nie możemy 
odpowiedzieć na pytanie, czy wykryty w tym badaniu drobnoustrój jest czynnikiem 
etiologicznym stanu zapalnego, zwłaszcza w dolnym odcinku układu oddechowego, czy 
potwierdziliśmy jedynie kolonizację patogenem, który nie jest przyczyną choroby. 
Dotyczy to zwłaszcza bakterii, których nosicielsto jest częste. W przypadku 
C. pneumoniae jest to, w połączeniu z badaniami serologicznymi zalecana metoda. 
W literaturze znajdują się opisy potwierdzające wykrycie tego patogenu w wydzielinie 
pobranej z oskrzeli w trakcie bronchoskopii, jednak nie jest to diagnostyka, która 
znajduje częste zastosowanie, zwłaszcza w ostrych stanach zapalnych [152]. Istotna 
różnica w częstości występownia C. pneumoniae w wymazie z gardła pomiędzy 
dziećmi chorymi a grupą kontrolną, wykazana zarówno w analizowanym badaniu, 
jak i w wielu wcześniej przytaczanych, świadczy o udziale bakterii w procesach 
zapalnych układu oddechowego. 
Wykazano, iż C. pneumoniae jest częstym czynnikiem etiologicznym zakażeń 
dróg oddechowych wśród najmłodszych dzieci. Dzieci w okresie niemowlęcym 
stanowiły 47% grupy zakażonej, a częstość zachorowań wśród nich była istotnie 
wyższa niż u dzieci w wieku przedszkolnym. Spośród 62 badanych niemowląt 


93
		

/p0094.djvu

			zakażenie potwierdzono u 16 z nich, co stanowiło 26% dzieci z objawami infekcji dróg 
oddechowych w tej grupie. U dzieci w 2. i 3. roku życia zakażenie potwierdzono 
u 10 z 56 badanych, czyli u 18%. Stanowiły one 29% grupy zakażonej, bez istotnych 
różnic co do częstości w porównaniu z niemowlętami. Chcąc ustalić, czy poza 
wykazaną powyżej istotną różnicą w częstości zakażenia C.pneumoniae pomiędzy 
niemowlętami a dziećmi w wieku przedszkolnym, infekcja ta ma szczególne znaczenie 
dla młodszych dzieci, w analizie zastosowano również inny od pierwotnie założonego 
podział grupy badanej. Po wyodrębnieniu grupy dzieci w wieku od O do 3 lat okazało 
się, że w tej populacji zakażenie C.pneumoniae występowało znamiennie częściej niż 
u dzieci w wieku powyżej 3 lat. Częstość występowania infekcji w tych grupach 
wynosiła odpowiednio 22% i 10% (p=0,027). Dane te wydają się mieć istotne znaczenie 
kliniczne dowodząc, iż C. pneumoniae jest często występującym patogenem 
u najmłodszych dzieci z zakażeniem zarówno górnego jak i dolnego odcinka układu 
oddechowego. Uzyskane wyniki pokazują, iż ww. czynnik powinien być uwzględniany 
w diagnostyce zmierzającej do ustalenia etiologii tych schorzeń we wszystkich grupach 
wiekowych, również u najmłodszych pacjentów. Wydaje się to istotne, zwłaszcza po 
uwzględnieniu, że właśnie dzieci w tym wieku najczęściej wymagają hospitalizacji 
w przebiegu chorób układu oddechowego, czego dowodzi również nasze badanie. 
Zakażenie C. pneumoniae u niemowląt i małych dzieci potwierdzili w swoich 
badaniach liczni autorzy, którzy w diagnostyce zastosowali metodę PCR [46, 53, 113, 
123,151,173]. 
Szerokie badanie dotyczące roli C. pneumonlae w etiologii zakażeń układu 
oddechowego u dzieci oraz ich przebiegu klinicznego przeprowadzili na terenie 
Niemiec Schmidt i wsp. Objęło ono blisko 800 hospitalizowanych dzieci w wieku od 
6 tygodni do 17 lat. W diagnostyce w kierunku zakażenia C. pneumoniae uwzględniono 
zarówno badanie wymazów z gardła metodą PCR jak i badania serologiczne, w których 
oznaczano swoiste przeciwciała w klasie A, M i G oraz zmianę stężenia IgG i IgA 
w dwukrotnych oznaczeniach. Na podstawie tak szerokiej diagnostyki potwierdzili oni, 
przynajmniej jedną z wymienionych metod, występowanie ostrego zakażenia 
C. pneumoniae u 28% badanych. Potwierdzono również zakażenia w grupie niemowląt 
i małych dzieci, uzyskując wynik dodatni, najczęściej metodą PCR. Infekcję 
C. pneumoniae stwierdzono u 11 % pacjentów w pierwszym półroczu życia. Dzieci 
w pierwszym i drugim roku życia stanowiły 57% grupy z potwierdzonym tą metodą 
zakażeniem. Zauważono również, iż połączenie metod bezpośredniej detekcji bakterii 


94
		

/p0095.djvu

			z analizą stężenia swoistych przeciwciał pozwala na rozpoznanIe ostrej infekcji 
u większej grupy chorych dzieci niż zastosowanie tylko jednej z wymienionych metod. 
Badanie swoistych przeciwciał zwiększyło ilość postawionych rozpoznań przede 
wszystkim u dzieci w wieku powyżej 5 lat. Spośród analizowanych wyników badań 
serologicznych największą wartość diagnostyczną miało oznaczenie przeciwciał IgG 
i IgA w dwukrotnie pobranych surowicach [151]. 
W przeprowadzonym wśród poznańskich dzieci badaniu, spośród 34 dzieci 
z potwierdzonym metodą nested-PCR zakażeniem C. pneumoniae, u 28 wykonano 
jednorazowe oznaczenie swoistych przeciwciał w klasach A, M i G metodą ElA. 
Ponieważ do tej diagnostyki wykorzystano krew pobieraną w trakcie wykonywania 
innych badań laboratoryjnych, zgodnie ze standardami obowiązującymi na 
poszczególnych oddziałach, na których hospitalizowane były zakażone dzieci, średni 
czas od początku infekcji do chwili pobrania wynosił 16 dni, jednak w przypadku 
poszczególnych dzieci był on różny i wahał się od 3 do 60 dni. Przeprowadzone w ten 
sposób oznaczenia wykazały brak korelacji pomiędzy wynikami uzyskanymi 
z wykorzystaniem metod biologii molekularnej a wynikami badań serologicznych. 
W oparciu o te badania nie wykazano ostrej infekcji u żadnego z badanych dzieci. 
W przypadku jednego pacjenta (sześciomiesięczne dziecko) uzyskano stężenie IgG 
uznawane przez laboratorium, wykonujące analizy, za wynik dodatni. Jednak biorąc 
pod uwagę wiek dziecka oraz klasę przeciwciał, nie można jednoznacznie ocenić, czy są 
one wynikiem infekcji czy transferu przezłożyskowego przeciwciał matczynych, które 
mogą utrzemywać się w krwi dziecka nawet 6 miesięcy [151]. Przy interpretacji 
uzyskanych wyników należy pamiętać, iż 76% dzieci z potwierdzonym metodą 
nested-PCR zakażeniem, miało w chwili badania poniżej 3 lat, a jak wynika z licznych 
publikacji, rzadko uzyskuje się dodatni wynik badania serologicznego w tej grupie 
wiekowej. 
W badaniu Normana i wsp., obejmującym 360 pacjentów z infekcją układu 
oddechowego, w grupie najmłodszych dzieci, poniżej 2 lat, z dodatnim wynikiem 
w badaniu metodą PCR, u 90% nie stwierdzono swoistych przeciwciał, analizując 
zarówno poziom immunoglobulin w klasie A, M i G, jak i czterokrotny wzrost poziomu 
IgG w stosunku do wyjściowego w surowicy pobranej w okresie zdrowienia [78, 123, 
151]. Uzyskane w analizowanym badaniu wyniki badań serologicznych mają istotne 
znaczenie praktyczne. Pokazują bowiem, iż wykonanie oznaczeń swoistych przeciwciał 
przeciw C. pneumoniae w trakcie hospitalizacji dziecka z zakażeniem układu 


95
		

/p0096.djvu

			oddechowego mo ze nIe być pomocne w podjęciu decyzji o właściwym leczeniu. 
Przeciwciała w klasie M, uznawane za wykładnik pierwszorazowej, ostrej infekcji, 
pojawiają się po około 2-3 tygodniach od początku choroby. Zalecana metoda badania 
par surowic, w przypadku pierwszorazowej infekcji C. pneumoniae, a z taką najczęściej 
mamy do czynienia w przypadku małych dzieci, wymaga pobrania materiału 
w odstępie 3 tygodni od pierwszego badania [42, 102]. Biorąc pod uwagę te dane, 
należy mieć świadomość, iż przy zastosowaniu badań serologicznych wynik 
potwierdzający zakażenie uzyskuje się po wielu dniach od rozpoczęcia choroby, a na 
podstawie wyniku uJemnego nIe mozna wykluczyć istniejącego zakażenia. 
Zróżnicowane wyniki dotyczące częstości występowania zakażenia C. pneumoniae 
u dzieci, prezentowane przez wielu autorów, związane są niewątpliwie z brakiem 
standaryzacji w zakresie zastosowania metod diagnostycznych, wykrywających 
obecność bakterii. Obecnie uważa się, iż najbardziej czułą diagnostyką połączenie 
metod biologii molekularnej z serologicznymi, zwłaszcza dwukrotnym oznaczaniem 
swoistych przeciwciał w surowicy krwi pobranej w odstępie 2-3 tygodni [42, 151]. 
W obec trudności diagnostycznych zakażenia C. pneumoniae, z powodu niewielkiej 
dostępności w codziennej praktyce i wysokich kosztów badań molekularnych, oraz 
małej wartości samych badań serologicznych, szczególnego znaczenia nabiera analiza 
przebiegu chorób o etiologii C. pneumoniae. Istotne wydaje się znalezienie odpowiedzi 
na pytanie, czy istnieją specyficzne dla tego zakażenia objawy lub wyniki badań 
dodatkowych, które stanowiłyby wskazówkę do podjęcia odpowiedniego leczenia. 
W niniejszej pracy starano się również ustalić, czy istnieją czynniki zwiększające 
ryzyko zakażenia tym patogenem. 
Nie stwierdzono aby przebywanie dziecka w dużych zbiorowościach, typu 
żłobek, przedszkole czy szkoła, było czynnikiem predysponującym do zakażenia 
C .pneumoniae. Różnica pomiędzy odsetkiem dzieci uczęszczających do wymienionych 
placówek z grupy zakażonej i niezakażonej nie była istotna statystycznie, natomiast 
mała ilość potwierdzonych zakażeń w grupie kontrolnej (2 pacjentów) uniemożliwia 
interpretację tych zależności. 
Podobne wnioski, dotyczące braku wpływu uczęszczanIa dzieci do placówek 
dziennej opieki na częstość zakażenia C. pneumoniae, wyciągnęli ze swojego badania 
Dal Molin w wsp. Oceniali oni m.in. zależność seroprewalencji wśród dzieci szkolnych 
od różnych czynników, z uwzględnienim m.in. ich pobytu w ww. placówkach w okresie 
wczesnego dzieciństwa [34]. Na podstawie danych z literatury należy się jednak liczyć 


96
		

/p0097.djvu

			z możliwością wyższego odsetka nosicieli C. pneumoniae oraz okresowej zwiększonej 
zachorowalności w placówkach dziennej opieki, domach pomocy społecznej czy 
koszarach [45,72, 123, 167]. 
Nie wykazano również związku pomiędzy częstością zakażeń i porą roku. 
Analizując odsetek pobranych wymazów z gardła, w których potwierdzono zakażenie 
C. pneumoniae, można zauważyć, iż jest on wyższy w sierpniu i wrześniu, i wynosi 
odpowiednio 50% i 75%. W analizie tego zjawiska nie można pominąć jednak faktu 
bardzo małej ilości badań wykonanych w tych miesiącach, co uniemożliwia 
interpretację danych. Nie stwierdzono natomiast znamiennych różnic pomiędzy 
mIeSIącamI, w których wykonano większą ilość badań. W analizie Schmidta 
i wsp. zwiększoną częstość infekcji układu oddechowego o etiologii C. pneumoniae 
stwierdzono pomiędzy listopadem a lutym [151]. Zjawisko to potwierdzono w dwóch 
kolejnych latach. Inni badacze zauważyli również zwiększoną częstość zakażeń 
w okresie zimowym [136]. Dane zebrane przez Schmidta i wsp., pokazały jednak, 
iż zakażenia C. pneumoniae wśród dzieci do lat 6 występują częściej nie tylko 
w miesiącach zimowych, ale w okresie od listopada do maja [151]. 
Ponieważ w analizowanym przez nas badaniu ponad 75% grupy zakażonej 
stanowili pacjenci do 3 lat, a miesiące sierpień i wrzesień nie powinny być brane pod 
uwagę w ustalaniu związku pomiędzy porą roku a częstością zakażenia, uzasadniony 
wydaje się brak stwierdzenia takiej zależności. 
Nie stwierdzono różnic w rozkładzie płci pomiędzy grupą z potwierdzonym 
zakażeniem C. pneumoniae, a grupą dzieci z zakażeniem układu oddechowego o innej 
etiologii. Wyniki te są zgodne z uzyskanymi przez innych badaczy [123, 151]. Należy 
również dodać, iż wśród dorosłych zakażenie C. pneumoniae występuje częściej 
u mężczyzn [102]. 
Nie stwierdzono zwiększonej predyspozycji do zakażeń C.pneumoniae u dzieci 
z chorobami przewlekłymi takimi jak: wady układu krążenia, choroby o podłożu 
alergicznym, przewlekłe choroby układu oddechowego oraz zaburzenia neurologiczne. 
71 % dzieci z potwierdzonym zakażeniem to dzieci bez współistniejących chorób 
przewlekłych. Znamiennie częściej jednak stwierdzono zakażenie u dzieci 
z niedoborami odporności w zakresie odpowiedzi humoralnej. Badania głównych klas 
przeciwciał przeprowadzone były ze wskazań klinicznych, zgodnie z zasadami 
obowiązującymi na oddziałach, na których przebywały dzieci. U wszystkich pacjentów, 
u których wykazano hipogammaglobulinemię, potwierdzono zakażenie C. pneumoniae, 


97
		

/p0098.djvu

			a dzieci te stanowiły 12% grupy zakażonej. Istnieje niewiele doniesień na temat 
związku zakażenia C. pneumoniae u dzieci z zaburzeniami odporności. W cytowanych 
wcześniej badaniach, dotyczących epidemiologii oraz przebiegu klinicznego, nie 
analizowano również wpływu chorób przewlekłych na częstość zakażenia. Istnieją 
jednak dane pokazujące, iż wśród dorosłych pacjentów z zakażeniem HIV serologiczne 
potwierdzenie przebytego zakażenia C. pneumoniae uzyskiwano częściej w porównaniu 
z grupą osób zdrowych [9]. W literaturze można znaleźć również opis przypadku 
zakażenia C. pneumoniae, o bardzo ciężkim przebiegu klinicznym, u pacjenta 
z neutropenią w trakcie leczenia choroby Hodgkina, jak również pojedyncze informacje 
o ciężkim przebiegu zapaleń płuc o tej etiologii u niemowląt z zaburzeniami odporności 


[82, 120]. 


W kontekście niewielkiej ilości danych, dotyczących częstości zakażenia 
C. pneumoniae u dzieci z zaburzeniami odporności, mając na uwadze możliwy ciężki 
przebieg zakażenia, uzyskane w naszej pracy wyniki dotyczące znamiennie częstszego 
występowania zakażenia tym patogenem u dzieci z hipogammaglobulinemią, mogą stać 
się wskazówką w podejmowaniu decyzji o diagnostyce i leczeniu w tej grupie 


. 
 
pacJentow. 
Nie wykazano wpływu stosowania leków kortykosteroidowych drogą wziewną na 
częstość zakażenia dróg oddechowych C. pneumoniae, co w aspekcie szerokiego 
stosowania tych preparatów u pacjentów z astmą oskrzelową oraz potwierdzonego 
przez wielu badaczy wpływu bakterii na zaostrzenie astmy oskrzelowej, wydaje się być 
istotną informacją. 
Głównym celem analizy przebiegu klinicznego zapaleń w obrębie układu 
oddechowego ze współistniejącym zakażeniem C. pneumoniae było ustalenie, czy 
istnieją cechy kliniczne typowe dla infekcji o tej etiologii. 
Zakażenie C. pneumoniae potwierdzono u 22% dzieci hospitalizowanych 
z powodu zapalenia oskrzeli, 16% dzieci z zapaleniem płuc, 10% dzieci z zapaleniem 
tylko w obrębie górnych dróg oddechowych oraz u 14% dzieci przyjętych do szpitala 
z powodu zaostrzenia astmy oskrzelowej, jednak różnice pomiędzy ww. grupami są 
nieistotne statystycznie. Na podstawie powyższych wyników należy zauważyć, 
iż zakażenie C. pneumoniae nie jest związane z konkretną postacią kliniczną choroby 
i może wywoływać stan zapalny zarówno w obrębie górnego jak i dolnego odcinka 
układu oddechowego. Dane te znajdują potwierdzenie w badaniach innych autorów. 


Schmidt i wsp. 


nie stwierdzili różnicy w częstości występowania zakażenia 


98
		

/p0099.djvu

			c. pneumonlae pomiędzy pacjentami z zapaleniem górnych i dolnych dróg 
oddechowych [151]. W badaniu Wangronsarba i wsp., obejmującym dzieci w wieku od 
1 miesiąca do 5 lat hospitalizowanych w Tajlandii, zakażenie potwierdzono u 14% 
dzieci z zapaleniem płuc, 16% z zapaleniem oskrzeli oraz 13% dzieci z objawami 
zapalenia górnych dróg oddechowych [173]. Normann i wsp. potwierdzili zakażenie 
u 22% dzieci z chorobami górnych dróg oddechowych oraz u 13% dzieci z zapaleniem 
płuc i takiego samego odetka dzieci z zapaleniem oskrzeli. Nie stwierdzili oni związku 
zakażenia z astmą oskrzelową [123]. 
W analizie porównawczej, obejmującej przebieg kliniczny infekcji w grupIe 
dzieci z zakażeniem C. pneumoniae oraz z ujemnym wynikiem badania w kierunku 
zakażenia tym patogenem, nie stwierdzono wielu różnic. Gorączka w trakcie infekcji, 
z uwzględnieniem zarówno okresu poprzedzającego przyjęcie do szpitala, jak i okresu 
hospitalizacji, występowała u zbliżonego odsetka dzieci z obu grup (grupa Z-50%, 
grupa NZ-56%). Nie stwierdzono również związku pomiędzy występowaniem 
duszności oraz objawami obturacji w drogach oddechowych u pacjentów ze stanem 
zapalnym dolnego odcinka układu oddechowego a zakażeniem C. pneumoniae. Mimo, 
iż część badaczy łączy zakażenia bakteriami atypowymi ze zwiększoną częstością 
występowania epizodów obturacji, ani Schmidt ze wsp., którzy analizowali przebieg 
infekcji układu oddechowego w grupie blisko 800 hospitalizowanych dzieci, ani 
Normann ze wsp., na podstawie obserwacji 367 dzieci, nie potwierdzili związku 
pomiędzy zakażeniem tym patogenem a predyspozycją do obturacji dróg oddechowych 
w czasie ostrego stanu zapalnego [46, 123, 151]. 
W bardzo szerokiej analizie przebiegu klinicznego zakażenia C. pneumonlae 
u dzieci, Schmidt i wsp. ocenili w badaniach czynnościowych zarówno parametry 
dotyczące przepływu w drogach oddechowych jak i określające pojemności płuc. 
Oznaczyli oni natężoną objętość wydechową pierwszosekundową (FEVI), natężony 
przepływ wydechowy na poziomie 25% i 50% natężonej pojemności życiowej (MEF 2s , 
MEF so ), pojemność życiową (VC) oraz wyznaczyli całkowitą pojemność płuc (TLC). 
Nie stwierdzono różnic w zakresie wymienionych parametrów pomiędzy grupą 
z potwierdzonym zakażeniem C. pneumoniae oraz dziećmi z zapaleniem układu 
oddechowego o innej etiologii [151]. 
Nie stwierdzono specyficznych dla zakażenia C. pneumoniae zmian w badaniu 
radiologicznym płuc. Zarówno w grupie NZ jak i Z dominowały zmiany zapalne 
o charakterze odoskrzelowym, odpowiednio w 81 % i 79%. Obustronne zmIany 


99
		

/p0100.djvu

			stwierdzono u 23% dzieci z potwierdzonym zakażeniem oraz w takim samym odsetku 
dzieci niezakażonych. Lite zmiany obejmujące płat stwierdzono u 9% dzieci z grup Z 
oraz u 14% dzieci z grupy NZ, jednak różnice te nie były znamienne statystycznie. 
Wyniki te są zgodne z obserwacjami innych badaczy, którzy również nie stwierdzili aby 
z zakażeniem C. pneumoniae łączyły się specyficzne zmiany uwidocznione na zdjęciu 
rentgenowskim płuc [86, 102]. 
Nie stwierdzono związku pomiędzy zakażeniem C. pneumonlae a ostrym 
zapaleniem ucha środkowego. Zapalenie zatok przynosowych, rozpoznawane na 
podstawie badania radiologicznego, wykonywanego ze wskazań klinicznych, 
znamiennie częściej rozpoznano u pacjentów bez zakażenia C. pneumoniae. Na 
podstawie danych z literatury wiadomo, iż patogen ten może wywoływać stan zapalny 
w obrębie zarówno ucha środkowego jak i zatok przynosowych [102]. Szmidt i wsp. 
stwierdzili zakażenie C. pneumoniae metodą PCR u 8% dzieci z zapaleniem ucha 
środkowego oraz 9% z zapaleniem zatok, a po uwzględnieniu dodatkowo kryterium 
serologicznego w potwierdzeniu ostrej infekcji, wśród pacjentów ze stanem zapalnym 
o takim umiejscowieniu, zakażenie potwierdzono odpowiednio u 14% i 27% [151]. 
Trudno znaleźć przyczyny rozbieżności, pomiędzy analizowanym badaniem 
a wynikami niemieckimi. Należy jednak dodać, iż w badaniu niemieckim nie podano, 
jakie kryteria stanowiły o rozpoznaniu zapalenia zatok. W prezentowanej pracy 
zapalenie zatok rozpoznawano, gdy w obrazie radiologicznym stwierdzono w zatokach 
płyn lub ich całkowite zacienienie. Diagnostyka w kierunku zapalenia ucha środkowego 
polegała na badaniu otoskopowym wykonywanym przez laryngologa, należy jednak 
dodać, iż nie u wszystkich dzieci przeprowadzono tę ocenę. Na podstawie uzyskanych 
danych należy stwierdzić, iż zapalenie ucha środkowego w przebiegu zakażenia 
C. pneumoniae występuje tak samo często jak w infekcjach o innej etiologii. 
Nie wykazano, aby u dzieci z zakażeniem C. pneumoniae znamiennie częściej 
w porównaniu z pacjentami niezakażonymi, obserwowano objawy spoza układu 
oddechowego. Analiza taka ma istotne znaczenie w ocenie ciężkości przebiegu 
zakażenia, biorąc pod uwagę szerokie spektrum objawów opisywane w literaturze 
i łączone z zakażeniem C. pneumoniae. 
W analizowanym badaniu, spośród objawów spoza układu oddechowego 
najczęściej, bo u 24% dzieci z potwierdzonym zakażeniem, obserwowano biegunkę 
(w analizie nie uwzględniono tego objawu, jeśli rozpoczął się w drugiej lub kolejnej 
dobie hospitalizacji, z uwagi na częste zakażenia wewnątrzszpitalne mi.in rotawirusami 


100
		

/p0101.djvu

			oraz dzieci, u których potwierdzono zakażenie rotawirusowe lub bakteriami z rodzaju 
Salmonella bez względu na moment wystąpienia objawu). W grupie bez zakażenia 
C. pneumoniae objaw ten występował u 20% pacjentów. Nie stwierdzono jednak 
istotnej różnicy między grupami. 
W literaturze znaleźć mozna OPISY pojedynczych przypadków zakażeń 
C. pneumonlae o bardzo ciężkim przebiegu klinicznym, m.in. dziewczynki 
z zapaleniem płuc i ostrym krwotocznym zapaleniem osierdzia, u której w płynie 
osierdziowym wykryto C. pneumoniae [164]. Z tego względu na uwagę zasługuje 
przypadek siedmiomiesięcznego dziecka z naszego badania, u którego również 
w przebiegu zakażenia doszło do rozwoju zapalenia płuc oraz zapalenia osierdzia. Tego 
jednego przypadku nie należy ujmować w analizie ststystycznej, ale potwierdza on, 
w połączeniu z danymi z literatury, że w przebiegu zakażenia C. pneumoniae można 
spodziewać się poważnych objawów ze strony innych narządów. 
Spośród analizowanych parametrów, cechą, która różnicuje przebieg choroby 
u dzieci zakażonych C. pneumoniae z grupą bez potwierdzonego zakażenia, jest długość 
trwania infekcji przed przyjęciem pacjenta do szpitala. Czas ten był znamiennie dłuższy 


, 
w grupie dzieci z infekcją o etiologii C. pneumoniae. Srednia w grupie Z wynosiła 
9,9 dnia, natomiast w grupie NZ 4,5 dnia, mediana odpowiednio 7,0 oraz 4,0 dni. Na 


podstawie 


tych 


danych 


mozna 


. , 
wycIągnąc 


wniosek, 


. . 
IZ 


choroba wywołana 


C. pneumoniae miała częściej, w porównaniu z infekcjami wywołanymi innymi 
czynnikami, łagodny początek. Podobne doświadczenia mają również inni autorzy [4]. 
Wykazano również różnice pomiędzy grupami Z i NZ w stężeniu białka 


, 
C-reaktywnego - nieswoistego wykładnika stanu zapalnego. Srednia wartość CRP 
w grupie z potwierdzonym zakażeniem C. pneumoniae wynosiła 14,4mg/1 natomiast 
w grupie niezakażonej 28, 1 mg/l, mediana wynosiła odpowiednio 5,0 mg/l i 9,0 mg/l 
w ww. grupach. Znamiennie wyższy był również odsetek dzieci w grupie Z, u których 
wartość CRP mieściła się w zakresie normy (59% w grupie Z, 38% w grupie NZ). 
Uważa się, iż nieswoista odpowiedź zapalna w przebiegu zakażeń C. pneumoniae, 
w tym również w przebiegu zapaleń płuc o tej etiologii jest zbliżona do reakcji na 
zakażenia wirusowe [112]. Zgodnie z naj nowszymi rekomendacjami dotyczącymi 
postępowania w pozaszpitalnych zakażeniach układu oddechowego u dzieci, należy 
pamiętać jednak, iż stężenie białek ostrej fazy w krwi dzieci z pozaszpitalnym 
zapaleniem płuc nie pozwala na odróżnienie infekcji bakteryjnej od wirusowej [81]. 
W swoich badaniach Normann i wsp. nie wykazali różnicy pomiędzy stężeniem białka 


101
		

/p0102.djvu

			C-reaktywnego u dzieci z zakażeniem C. pneumoniae oraz z inną etiologią choroby 
[123]. Przy analizowaniu laboratoryjnych wykładników stanu zapalnego oraz przebiegu 


klinicznego 


choroby, 


należy 


. , 
pamIętac, 


iż jak podaje 


wielu 



 
autorow, 


C. pneumoniae często współwystępuje z innymi zakażeniami. Infekcja kolejnym 
patogenem może mieć istotny wpływ, zarówno na wyniki badań dodatkowych, jak 
i przebieg kliniczny. Schmidt i wsp. badali wymazy z gardła nie tylko w kierunku 
zakażenia C. pneumoniae, ale także oceniając kolonizację przez inne bakterie. 
Poszerzyli oni również diagnostykę o badanie specyficznych przeciwciał przeciw 
Mycoplasma pneumoniae, wirusom grypy typu A i B, Respiratory Syncytial Vi rus 
(RSV), adenowirusom oraz wirusowi paragrypy 3. Pozytywny wynik badania wymazu 


z gardła w kierunku 


C. pneumonlae był 


.. , . . 
znamIennIe częscIeJ 


zWIązany 


z potwierdzeniem kolonizacji przez Inne patogeny w porównaniu z wynikami 
niepotwierdzającymi zakażenia C. pneumoniae. Nie wykazano jednak istotnego 
związku z konkretną bakterią. Wśród pacjentów z ostrą infekcją C. pneumoniae, 
potwierdzoną badaniem swoistych przeciwciał, wykazano częste współwystępowanie 
tej infekcji z zakażeniem Mycoplasma pneumoniae oraz rzadsze, lecz statystycznie 
znamIenne, powiązanie z zakażeniem wirusem grypy A [151]. Podobne wyniki 
uzyskali w swoim badaniu Esposito i wsp., ustalając etiologię zapalenia gardła i rolę 
bakterii atypowych w tym schorzeniu. U ponad 75% pacjentów z ostrą infekcją 
C. pneumoniae potwierdzono również zakażenie innymi czynnikami chorobotwórczymi 
(diagnostyką objęto takie patogeny jak RSV, adenowirusy, Mycoplasma pneumoniae, 
Streptococcus pyogenes) [47]. 
Interesujące wydają się obserwacje dotyczące skuteczności leczenia pacjentów 
zakażonych C. pneumoniae. Spośród 34 dzieci z potwierdzonym zakażeniem leczenie 
antybiotykiem makrolidowym podjęto u 14, co stanowiło 41 % grupy Z. Leczenie tym 
antybiotykiem stosowano ze wskazań klinicznych. U żadnego z dzieci nie 
rozpoczynano antybiotykoterapii od leku z tej grupy. U wszystkich 34 dzieci 
w momenCIe przyjęcia do szpitala rozpoczynano lub kontynuowano rozpoczętą 
wcześniej antybiotykoterapię. Nie zmieniano antybiotyku, ani nie dołączano makrolidu 
jako drugiego leku przeciwdrobnoustrojowego, jeżeli w momencie uzyskania wyniku 
potwierdzającego zakażenie obserwowano ustąpienie objawów choroby lub znaczną 
poprawę, mimo braku celowanego leczenia. Stosowano natomiast makrolid, gdy nie 
uzyskiwano poprawy po zastosowaniu antybiotyku pierwszego wyboru, którym był 
najczęściej antybiotyk betalaktamowy. Zgodnie z przedstawionymi zasadami 20 dzieci 


102
		

/p0103.djvu

			(59% grupy Z) nie wymagało leczenia makrolidem. Obserwacja ta jest zgodna z danymi 
z badania Esposito i wsp., którzy zauważyli, iż większość pacjentów, u których 
w przebiegu zapalenia gardła potwierdzono zakażenie C. pneumoniae, nie wymagało 
antybiotykoterapii i mimo braku leczenia nie dochodziło u nich do nawrotów. 
Odmiennie natomiast przebiegało zakażenie Mycoplasma pneumoniae, które nieleczone 
powodowało długie utrzymywanie się gorączki oraz szybki nawrót objawów [47]. 
Dzieci, u których nIe zastosowano leczenia antybiotykiem potencjalnie 
skutecznym w stosunku do C. pneumoniae, opuszczały szpital z zaleceniem 
zastosowania takiego leku w razie kolejnej infekcji układu oddechowego wymagającej 
leczenia. Analiza okresu od zakończenia hospitalizacji do wizyty kontrolnej, którą 
przeprowadzono u 23 dzieci z grupy Z, wykazała, iż do czasu pobrania kontrolnego 
wymazu z gardła, co miało miej sce po 7 do 20 miesiącach od zakończenia 
hospitalizacji, 7 dzieci nie otrzymało takiego antybiotyku ani w szpitalu, 
ani w późniejszym czasie. Kontrolna wizyta, połączona z pobraniem wymazu z gardła, 
miała miejsce w okresie zdrowia. Badanie w kierunku C. pneumoniae metodą nested- 
PCR przeprowadzono u 23 dzieci, u których uprzednio, w przebiegu zakażenia układu 
oddechowego, potwierdzono obecność bakterii. Na podstawie tego badania wykazano, 
iż u 22 z 23 badanych dzieci (96%) doszło do eliminacji bakterii C. pneumoniae 
z gardła. Dziecko, u którego utrzymywało się nosicielstwo nie było leczone 
makrolidem, a po zakończonej hospitalizacji nie obserwowano nawrotów choroby i nie 
wymagało ono leczenia antybiotykiem. U pozostałych 6 nieleczonych, w sposób 
celowany, dzieci doszło do samoistnej eliminacji patogenu. Spośród 22 dzieci, 
u których doszło do wyeliminowania C. pneumonlae z gardła, 27% nie otrzymało 
antybiotyku zalecanego do leczenia zakażenia tym patogenem. Jest to kolejna 
obserwacja poczyniona w trakcie badania, która z racji niewielkiej grupy ma mniejszą 
wartość z punktu widzenia analizy statystycznej, ale stanowi cenną informację. Dane te 
mogą być pomocne w przypadku dzieci z zakażeniem układu oddechowego o łagodnym 
przebiegu, u których istnieją przeciwwskazania do podjęcia terapii antybiotykiem 
makrolidowym. Na uwagę zasługuje fakt, iż 80% dzieci, u których nie zastosowano 


leczenia antybiotykiem 


makrolidowym w 


trakcie hospitalizacji, 


to 


. . 
pacJencI 


z zapaleniem płuc, pozostałe 20% stanowiły dzieci z zapaleniem oskrzeli. Dane te, 
łącznie z cytowanym wcześniej badaniem Esposito, pokazują, iż potwierdzenie 
obecności C. pneumoniae w gardle u pacjentów ze stanem zapalnym w układzie 
oddechowym, w tym również w jego dolnym odcinku, nie musi być bezwzględnym 


103
		

/p0104.djvu

			wskazaniem do zastosowania celowanej terapii, jeżeli nie ma przesłanek klinicznych do 
podjęcia takiego działania. 
Na podstawie analizy danych uzyskanych w badaniu, a dotyczących 
epidemiologii oraz przebiegu klinicznego zakażeń C. pneumoniae, należy stwierdzić, 
iż zakażenie tym patogenem jest częste w populacji dzieci. Bakteria ta jest istotnym 
czynnikiem infekcyjnym w okresie niemowlęcym oraz wczesnego dzieciństwa. Dane te 
mają istotne znaczenie kliniczne, zwłaszcza w kontekście najnowszych rekomendacji, 
zgodnie z którymi nie zaleca się rutynowego wykonywania posiewu plwociny, wymazu 
z nosogardła oraz badań serologicznych identyfikujących etiologię zakażenia u dzieci 
z pozaszpitalnym zapaleniem płuc, a antybiotyki makrolidowe nie znajdują się wśród 
zalecanych dla dzieci pomiędzy 4. miesiącem a 5. rokiem życia [81]. 
Należy zwrócić uwagę, iż zaburzenia odporności są stanem predysponującym do 
zakażenia C. pneumoniae, jednak zdecydowana większość dzieci, u których w wymazie 
z gardła potwierdzono obecność tego patogenu, to dzieci wcześniej zdrowe. 
C. pneumoniae może być czynnikiem etiologicznym stanu zapalnego zarówno 
w górnym jak i dolnym odcinku układu oddechowego. Najczęściej przebieg zakażenia 
ma charakter łagodny, częściowo samoograniczający, ale jak wynika z przytaczanego 
wcześniej piśmiennictwa, bakteria ta może wywoływać również zakażenie układu 
oddechowego o ciężkim przebiegu oraz stan zapalny w obrębie licznych narządów poza 
układem oddechowym. W tym kontekście dane publikowane wcześniej przez Schmidta 
i Normanna oraz wyniki niniejszej pracy mają istotne znaczenie, ponieważ pokazują, 
że zakażenie tym patogenem, wbrew wcześniejszym opiniom, dotyczy często 
niemowląt i małych dzieci. 


Na podstawie objawów oraz wyników badań dodatkowych, 



 
zarowno 


laboratoryjnych, jak i radiologicznych, nie można podejrzewać etiologii C. pneumoniae 
w zapaleniach dróg oddechowych, ponieważ w przebiegu klinicznym nie ma cech, które 
odróżniają zakażenie tym drobnoustrojem od infekcji wywołanych innymi czynnikami. 
Diagnostyka, zwłaszcza u małych dzieci nie powinna opierać się jedynie na badaniach 
swoistych przeciwciał, zwłaszcza, że dodatnie wyniki można uzyskać przy pomocy tych 
metod dopiero po 2-3 tygodniach od rozpoczęcia choroby. Przede wszystkim jednak nie 
należy ograniczać się w diagnostyce zakażenia C. pneumoniae do metod serologicznych 
z powodu braku korelacji pomiędzy wynikami uzyskanymi za pomocą tych badań 
a wykrywaniem patogenu metodą PCR. Obserwacje te znajdują potwierdzenie 
w licznych publikacjach [46,47, 66, 123, 151, 166]. Należy również mieć świadomość, 


104
		

/p0105.djvu

			iż nie ma danych pokazujących czy zakażenie C.pneumoniae może być ograniczone 
jedynie do układu oddechowego oraz czy po pierwotnym zakażeniu może dojść do 
eliminacji patogenu z organizmu, czy przechodzi ono zawsze w postać utajoną, w której 
rezerwuarem stają się monocyty, limfocyty i makrofagi. Niepokojące są dane 
Normanna i wsp., którzy wykazali C. pneumoniae w tkankach migdałka gardłowego 
u ponad 98% pacjentów poddanych adenotomii [124]. Liczne doniesienia, pokazujące 
związek patogenu z chorobami przewlekłymi takimi jak astma oskrzelowa, miażdżyca 


tętnic, 


choroby układu nerwowego, 


choroby 



 
stawow, 


oraz uzyskane 


w naszeJ pracy, a poparte wynikami innych autorów, dane dotyczące częstości 
zakażenia C. pneumoniae, zwłaszcza u małych dzieci, dowodzą, iż zagadnienie to 
wymaga dalszych badań. 
Ze względu na coraz liczniejsze doniesienia literaturowe, wykazujące związek 
C. pneumoniae z chorobami przewlekłymi, bardzo ważne wydaje się poznanie 
mechanizmów odpowiedzi immunologicznej, zwłaszcza w zakresie odpowiedzi 
nieswoistej . Poznanie tych zagadnień może tłumaczyć patomechanizm zmian 
niezwiązanych z układem oddechowym. 
Stałe zagrożenie, jakie stanowią drobnoustroje chorobotwórcze, doprowadziło 
do rozwoju licznych mechanizmów obronnych, wśród których najważniejszą rolę pełni 
układ odpornościowy. Reaktywność immunologiczna oparta jest na mechanizmach 


zapewniaj ących 


odporność 


przeci w dro bnoustroj ową, 


odporność 


humoralną 


i komórkową. Dobrze już udokumentowano, że wytworzone przez komórki 
prezentujące antygen (głównie monocyty/makrofagi), tzw. cytokiny prozapalne IL-1 
i TNF-a pełnią w organizmie gospodarza funkcję "alarmową", indukując odpowiedź 
odpornościową i zapalną wobec różnych czynników uszkadzających, w tym 
drobnoustrojów i ich produktów [138, 162]. Cytokiny te odznaczają się szerokim 
zakresem działania immunostymulującego, prowadząc do aktywacji limfocytów T oraz 
B, równocześnie wzmagając ekspresję na komórkach śródbłonka molekuł adhezyjnych, 
co zapewnia rozwój odczynu zapalnego. Fizjologicznym zadaniem tego procesu jest 
neutralizacja i usunięcie czynnika wywołującego zapalenie oraz reperacja uszkodzonej 


tkanki [142, 150, 162]. 
Najsilniejszym bodźcem do wytwarzania TNF-a są lipopolisacharydy (LPS) 
ścian komórkowych bakterii. W badaniach Jiang i wsp. [91] wykazano, że w przypadku 
C. pneumoniae oprócz LPS wpływ na produkcję TNF-a mają również białka m.in. 
białko błony zewnętrznej OMP (outer membrane protein). TNF-a działa 


105
		

/p0106.djvu

			chemotaktycznie na monocyty i neutrofile, aktywując je podobnie jak makrofagi. 
Stanowi on ważny element odporności przeciwzakaźnej, prawdopodobnie wzmagając 
również sekrecję IFN-y [1, 89] oraz syntezę innych cytokin prozapalnych zwłaszcza 
IL-1, a także mediatorów procesów zapalnych jak hormony (adrenalina, noradrenalina, 
ACTH), eikozanoidy, endoteliny, białka szoku termicznego (HSP) [2]. W badaniach 
Yang i wsp. [177] analizowano na poziomie komórkowym, w oparciu o hodowlę 
tkankową i badania molekularne, indukcję cytokin prozapalnych w komórkach 
nabłonkowych płuc podczas zakażenia C. pneumoniae. Dowiedziono, że istotne 
znaczenie w ich uwalnianiu pełni przyleganie mikroorganizmów do powierzchni 
komórek nabłonka. Ponadto stwierdzono wyraźny wzrost ekspresji genów niezbędnych 
do wytwarzania cytokin prozapalnych takich jak IFN-y i TNF-a [177]. 
W patogenezie zakażenia Chlamydophila pneumoniae sugeruje się istotną rolę 
cytokin, szczególnie IFNy, prawdopodobnie związanego z eliminacją zakażenia. 
Indukcja cytokin prozapalnych przez ten wewnątrzkomórkowy patogen 
naj prawdopodobniej wpływa nie tylko na patogenezę zakażeń ostrych układu 
oddechowego, ale także tych o przebiegu przewlekłym oraz na procesy rozwoju 
miażdżycy [140, 148]. IFN-y działa również pobudzająco na aktywację makrofagów, 
a także zwiększa wytwarzanie nadtlenków zarówno w makrofagach jak i neutrofilach, 
nasilając ich zdolność do zabijania bakterii [142]. IFN-y stanowi kostymulator 
komórek Th1, oddziałując supresyjnie wobec Th2 [145]. Wewnątrzkomórkowa postać 
C. pneumoniae - ciałko RB, chroni drobnoustrój przed odpowiedzią humoralną 
gospodarza. Wykazano także, w badaniach in vitro, że uruchomiona na skutek 
odpowiedzi immunologicznej gospodarza synteza cytokin IFN-y i TNF-a prowadzi do 
wstrzymania cyklu rozwojowego patogenu na etapie ciałka siateczkowatego i rozwoju 
jego atypowych form (postaci przetrwałych) oraz prowadzi do zakażeń przewlekłych. 
Długotrwała obecność w komórkach C. pneumoniae skutkuje szeregiem reakcji 
zapalnych [43, 134]. 
IFN -y i IL-10 produkowane są głównie przez klony limfocytów T pomocniczych 
(Th) aktywowanych patogenem [127]. Istnienie dwóch głównych subpopulacji 
limfocytów Th wykazano początkowo na modelu mysim, a następnie potwierdzono 
występowanie tych różniących się czynnościowo populacji komórek Th u ludzi [116]. 
Subpopulacja Th1 wspomaga odpowiedź komórkową, produkując IFN-y i IL-2. 
Natomiast komórki Th2 warunkują optymalną odpowiedź humoralną, uwalniając IL-4, 
IL-5, IL-6 oraz IL-10, oddziaływującą silnie supresyjnie na wytwarzanie cytokin 


106
		

/p0107.djvu

			prozapalnych (IL-1, TNFa) oraz regulacyjnie na odpowiedź limfocytów Th [162]. 
Jedynie dynamiczny stan równowagi między aktywnością Th1 oraz Th2 zapewnia 
skuteczne funkcjonowanie komórkowego i humoralnego mechanizmu obronnego. 
IL-10 promuje humoralną odpowiedź immunologiczną i zapobiega patologii 
narządowej lub układowej, jako następstwa niekontrolowanego procesu zapalnego 
występującego niejednokrotnie na skutek długotrwałej stymulacji antygenowej [89, 
106, 115]. 
W tym kontekście, w niniejszej pracy, zasadnym było poznanIe 1 ocena 
endogennej sekrecji IFNy oraz cytokin prozapalnych: IL-1
, TNFa i przeciwzapalnej 
IL-10, oddziałujących podczas zakażenia C. pneumoniae u dzieci. Dokonano oznaczeń 
ilościowych cytokin: IFN-y, IL-1
, TNF-a i IL-10, z zastosowaniem testów 
immunoenzymatycznych (ELISA) wysokiej czułości, zapewniających znaczne 
zwiększenie wykrywalności, przy blisko 100% swoistości. 
W ostrym zakażeniu C. pneumoniae, w niniejszej pracy, w badanych surowicach 
dzieci wykazano umiarkowany wzrost poziomu IL-1 
 oraz znaczne zwiększenie 
krążącej IL-10. Z kolei poziomy TNF-a i IFN-y odpowiadały wartościom 
prawidłowym. Wyniki te wskazują na dominację limfocytów Th2 w następstwie ostrej 
infekcji C. pneumoniae, co wyraża się wzmożoną sekrecją IL-10. Jednocześnie w pracy 
tej stwierdzono niski poziom TNF-a i IFN-y w pierwszym terminie badania, co wydaje 
się być rezultatem oddziaływania supresyjnego IL-10. Z kolei, w okresie zdrowienia 
(II termin badania) w surowicy, poziom IL-10 odpowiadał statystycznie wartościom 
prawidłowym, natomiast poziomy TNF-a i IFN-y były istotnie zwiększone. Dane 
te mogą oznaczać, że zdrowienie z eliminacją patogenu determinowane jest 
zwiększonym wytwarzaniem TNF-a i IFN-y. Tak więc, jakkolwiek w chwili obecnej, 
trudno odnieść opisane w niniejszej pracy wyniki do innych tego rodzaju badań 
u dzieci, przynajmniej ich częściowym potwierdzeniem są doświadczenia in vitro, 
dokumentujące wstrzymanie cyklu rozwojowego C. pneumoniae w komórkach 
w następstwie syntezy TNF-a i IFN-y [2, 150, 162]. 
Bardzo duże zainteresowanie badaczy i lekarzy klinicystów w przecIągu 
ostatnich 15 lat budzi wpływ zakażenia C. pneumoniae na powstanie i rozwój zmian 
miażdżycowych. W badaniach Futterman i Lemberg [56] wykazano, że u połowy 
analizowanych pacjentów z objawami choroby wieńcowej nie występowały klasyczne 
czynniki ryzyka, sugerując inne przyczyny takie jak np. przebyte zakażenie patogenem 
C. pneumoniae [134]. Wskazuje się na istnienie dwóch hipotez patogenezy miażdżycy 


107
		

/p0108.djvu

			tzw. hipoteza lipidowa, a druga przewlekłego uszkodzenia śródbłonka. Wśród 
czynników powodujących uszkodzenie śródbłonka wymienia się lipoproteiny LDL oraz 
czynniki zakaźne takie jak C. pneumoniae. Na udział tego drobnoustroju wskazują 
badania serologiczne prezentujące częstsze występowanie przeciwciał 
anty-C. pneumoniae u osób z miażdżycą oraz obecność mikroorganizmu w zmianach 
miażdżycowych potwierdzoną w badaniach molekularnych przez Kuo i wsp. [102, 134]. 
W związku z danymi o przypuszczalnym udziale C. pneumoniae waterogenezie 
oraz niewielką liczbą dostępnych doniesień literaturowych na temat zaburzeń 
gospodarki lipidowej u dzieci, zasadnym było zanalizowanie w naszej pracy, 
jej wykładników w przebiegu analizowanego zakażenia. Etiopatogeneza zmIan 
miażdżycowych, determinowana uszkodzeniem śródbłonka i wpływem wykładników 
gospodarki lipidowej oraz wczesna diagnostyka są nadal przedmiotem badań. Fakt ten 
jest zwłaszcza istotny w zakresie udziału waterogenezie niektórych patogenów, których 
działanie prowadzi do uszkodzenia komórek śródbłonka [15, 132, 147]. W badaniach 
Baumert'a i wsp. [5] wykazano aktywację komórek nabłonka, fibroblastów i komórek 
mięśni gładkich (SMC - smooth muscle cells), będących komórkami docelowymi ataku 
C. pneumoniae w blaszkach miażdżycowych, do produkcji cytokin m.in. TNF-a, 
wpływających na obniżenie ekspresji śródmiąższowego kolagenu i fibronektyn. Proces 
ten prowadzić może w konsekwencji do udziału C. pneumoniae w patogenezie 
przewlekłych chorób układu oddechowego i rozwoju miażdżycy w komórkach 
gospodarza [5, 91]. Dobrze udokumentowany jest związek rozwoju miażdżycy 
z zaburzeniami dotyczącymi gospodarki lipidowej, a hipercholesterolemia jest ważnym, 
chociaż nie jedynym, czynnikiem predysponującym do choroby wieńcowej, szczególnie 
w młodym wieku [35, 175, 147]. Zasadniczym nośnikiem cholesterolu jest frakcja LDL 
(low density lipoprotein). Przewaga małych, gęstych lipoprotein LDL wiąże się 
z podwyższonym stężeniem lipoprotein bogatych w triglicerydy oraz obniżonym 
stężeniem cholesterolu we frakcji HDL. Konfiguracja ta świadczy o obniżeniu 
transportu zwrotnego i sprzyja rozwojowi miażdżycy. Małe, gęste LDL dłużej 
przebywają w krążeniu i są bardziej podatne na modyfikację oksydacyjną, co potęguje 
ich proaterogenny charakter. Tlenek azotu (NO) wytwarzany przez komórki śródbłonka 
naczyniowego, wydaje się mieć udział w zapobieganiu modyfikacji LDL, działając 
antyoksydacyjnie-osłaniająco na natywne LDL. Zaburzenie tej równowagi sprzyja 
rozwojowi miażdżycy [35, 37,175]. Za transport zwrotny cholesterolu tzn. transport od 
komórek tkanek obwodowych do wątroby odpowiedzialne są lipoproteiny o wysokiej 


108
		

/p0109.djvu

			gęstości HDL (high density lipoprotein). W procesie tym następuje usuwanie nadmiaru 
lipidów od komórki obwodowej, a skończywszy na wydaleniu z organizmu. Stężenie 
cholesterolu we frakcji HDL ujemnie koreluje z ryzykiem powstania miażdżycy [41, 
148]. Dane w zakresie hipertriglicerydemii sugerują również związek poziomu 
triglicerydów (TG) i chorobą wieńcową oraz ich udział w progresji wczesnych zmian 
miażdżycowych [35, 37, 175]. Wartości referencyjne, które nie powodują wzrostu 
ryzyka rozwoju miażdżycy, opracowano na podstawie badań epidemiologicznych oraz 
obserwacji klinicznych, przedstawiają się następująco: dla cholesterolu całkowitego 
<200 mg/dl, dla frakcji LDL <130 mg/dl, dla frakcji HDL> 35 mg/dl, a dla TG <150 


mg/dl. Kliniczne źródła zmienności stężenia lipidów, oprócz zawału serca, nadciśnienia, 
czy niewydolności nerek, stanowią także zakażenia, stosowane leki, a także choroby 
przewlekłe i wpływ środowiska. Podczas zakażenia lub choroby przebiegającej 
z procesem zapalnym stężenie triglicerydów wzrasta, a stężenie cholesterolu 
całkowitego i HDL zmniejsza się. W związku z tym ryzyko powstania zmian 


miażdżycowych powinno być 


analizowane 



 
zarowno 


w 


kontekście 


, . 
wartoscI 


referencyjnych, ale także z uwzględnieniem różnorodnych czynników środowiskowych 
[37, 161]. Choroby układu krążenia coraz częściej dotyczą ludzi młodych i sugeruje się, 
że zmiany w śródbłonku naczyń, inicjujące proces miażdżycowy, rozpoczynają się już 
u najmłodszych pacjentów. Grupą szczególnie narażoną na rozwój wczesnych zmian 
miażdżycowych są dzieci z hipercholesterolemią. Hipercholesterolemie są zwykle 
bezobjawowe i nie prowadzą do poważnych powikłań w wieku dziecięcym [35, 175]. 
Prawidłowa funkcja komórek śródbłonka naczyń krwionośnych osłania ścianę naczyń 
przed zjawiskiem przebudowy, obserwowanym np. w procesie powstawania blaszki 
miażdżycowej. W miażdżycy dochodzi do miejscowych, rozsianych uszkodzeń 
śródbłonka. W wielu badaniach wykazano, że zmodyfikowane LDL, po przeniknięciu 
do ściany naczyń tzw. minimalnie zmodyfikowane LDL (mm-LDL), w ścianie naczynia 
ulegają dalszym przemianom (m-LDL). Tym samym stają się niejako inicjatorem wielu 
procesów skutkujących rozwojem blaszki miażdżycowej. Dochodzi między innymi do 
aktywacji płytek krwi, uwalniania czynników wzrostu i mitogenów, generacji wolnych 
rodników, indukcji chemoatraktantów, cytokin i czynników wzrostu w makrofagach. 
Makrofagi i histiomiocyty w sposób niekontrolowany fagocytują zmodyfikowane LDL, 
stając się komórkami piankowatymi. W blaszce miażdżycowej stwierdzono obecność 
wszystkich z poznanych mediatorów procesu zapalno-immunologicznego. Proces 
rozwoju miażdżycy charakteryzowany jest jako przewlekła odpowiedź zapalno- 


109
		

/p0110.djvu

			immunologiczna ściany naczynIa 1 całego organIzmu, wynikająca z uszkodzenia 
śródbłonka [37]. 
W niniejszej pracy dokonano oznaczeń wykładników gospodarki lipidowej 
u dzieci ze stwierdzonym zakażeniem C. pneumoniae i okazało się, że wszystkie 
analizowane parametry: cholesterol całkowity, frakcje LDL, HDL itriglicerydy, 
statystycznie spełniają kryteria wartości referencyjnych. Jednocześnie, porównując 
statystycznie wartości poszczególnych wykładników w grupie dzieci chorych i w grupie dzieci 
zdrowych nie wykazano istotnych różnic. W naszych badaniach nie uwzględniano surowic 
dzieci poniżej 2 roku życia. Fakt ten zgodny jest z opinią występowania w tym okresie 
indywidualnej zmienności biologicznej w zakresie oznaczeń składników lipidowych, 
podlegających wahaniom w szerokich granicach, a tym samym charakteryzujących się 
niewielkim praktycznym znaczeniem diagnostycznym [35, 37]. Wyniki uzyskane 
w niniejszej pracy w zakresie oceny wykładników gospodarki lipidowej u dzieci nie 
stanowią potwierdzenia dla zakażenia C. pneumoniae, jako czynnika prognostycznego 
u dzieci w indukcji aterogenezy. 


110
		

/p0111.djvu

			6. WNIOSKI 


1. Chlamydophila pneumonlae odgrywa istotną rolę w zakażeniach układu 
oddechowego u dzieci. Obecność tego patogenu potwierdzono u 17% pacjentów 
ze stanem zapalnym dróg oddechowych. Zakażenie występuje znamiennie 
częściej u dzieci w wieku od O do 3 lat. 


2. W zakażeniu dróg oddechowych wywołanym przez Chlamydophila pneumoniae 
brak jest cech klinicznych charakterystycznych dla tego patogenu, 
a potwierdzenie etiologii wymaga badań dodatkowych. 


3. Rozwój ostrego zakażenia C. pneumoniae u dzieci jest związany znadekspresją 
odpowiedzi cytokinowej typu Th2 wobec Th1, wyrażającej się znacznie wyższą 
produkcją IL-10 wobec sekrecji IFN-y. 


4. W ostrym zakażeniu C. pneumoniae dochodzi do umiarkowanej nadprodukcji 
IL-1
. Z kolei zdrowienie wraz z towarzyszącą eliminacją patogenu wydaje się 
być determinowane zwiększonym wytwarzaniem IFN-y i TNF-a. 


5. W ostrym zakażeniu C. pneumoniae u dzieci nie dochodzi do istotnych zmian 
wartości wykładników gospodarki lipidowej: cholesterolu całkowitego, 
cholesterolu frakcji LDL i HDL oraz triglicerydów (TG) w surowicy krwi. 


111
		

/p0112.djvu

			7. STRESZCZENIE 


Choroby infekcyjne układu oddechowego należą do najczęstszych zakażeń 
występujących u dzieci. W Polsce nadal brak dokładnych danych epidemiologicznych, 
zarówno co do częstości występowania samej infekcji, jak i poszczególnych czynników 
etiologicznych. 
Chlamydophila pneumonlae to obligatoryjnie wewątrzkomórkowy patogen 
atypowy, odgrywający istotną rolę w zakażeniach układu oddechowego. Drobnoustrój, 
uznawany za przyczynę ostrych zakażeń, obecnie zasługuje również na uwagę jako 
czynnik etiologiczny infekcji przewlekłych oraz ich powikłań. 
W patogenezie zakażenia C. pneumoniae sugeruje się istotną rolę cytokin 
prozapalnych, szczególnie IFNy, prawdopodobnie związanego z eliminacją zakażenia 
oraz cytokin przeciwzapalnych. Ponadto patogen ten może brać udział w powstawaniu 
i pogłębianiu zmian aterogennych, stanowiąc istotny czynnik ryzyka miażdżycy. 
Coraz częściej podkreśla się fakt, iż zakażenie drobnoustrojami atypowymi nie 
łączy się z charakterystycznym przebiegiem klinicznym infekcji, ani typowymi dla tego 
zakażenia wynikami badań laboratoryjnych i radiologicznych. Zróżnicowane dane 
o częstości występowania zakażenia C. pneumoniae zwłaszcza u dzieci, związane są 
z brakiem standaryzacji w zakresie stosowanych metod diagnostycznych. Obecnie 
sugeruje się połączenie metod diagnostyki molekularnej z badaniami serologicznymi. 
W niniejszej pracy badaniami objęto 202 dzieci (128 chłopców i 74 
dziewczynki) w wieku od 2 miesięcy do 16 lat, hospitalizowanych z powodu stanu 
zapalnego w obrębie układu oddechowego. U wszystkich w celu potwierdzenia 
zakażenia C. pneumoniae, wykonano wymaz z tylnej ściany gardła i zastosowano 
metodę nested-PCR. Obecność DNA C. pneumoniae stwierdzono u 34 (17%) z 202 
badanych dzieci. Dzieci w okresie niemowlęcym stanowiły 47% grupy zakażonej, 
a częstość zachorowań była istotnie wyższa niż u dzieci w wieku przedszkolnym. 
U 16 (26%) z 62 badanych niemowląt potwierdzono zakażenie C. pneumoniae. U dzieci 
w 2 i 3 roku życia zakażenie potwierdzono u 10 (18%) z 56 badanych. Małe dzieci 
stanowiły 29% grupy zakażonej, bez istotnych różnic co do częstości w porównaniu 
z niemowlętami. Uzyskane wyniki sugerują, iż C. pneumoniae jest często 
występującym patogenem u najmłodszych dzieci z zakażeniem zarówno górnego jak 
i dolnego odcinka układu oddechowego. W związku z tym drobnoustrój powinien być 


112
		

/p0113.djvu

			uwzględniany w diagnostyce pacjentów wszystkich grup wiekowych, równIez 
naj młodszych. 
U 28 z 34 dzieci, z potwierdzonym nested-PCR zakażeniem C. pneumoniae, 
dokonano, metodą ElA, jednorazowego oznaczenIa swoistych przeciwciał 
anty-C. pneumoniae w klasach: A, M i G. Nie wykazano korelacji pomiędzy wynikiem 
badania metodą biologii molekularnej a wynikami badań serologicznych. W oparciu 
o badania serologiczne nie stwierdzono ostrej infekcji u żadnego z badanych dzieci. 
Przy interpretacji wyników należy pamiętać, iż 76% dzieci z potwierdzonym 
nested-PCR zakażeniem C. pneumoniae, miało w chwili badania poniżej 3 lat, 
a sugeruJe się sporadyczne wyniki dodatnie badań serologicznych w tej grupIe 
wiekowej. Wykazano częstsze występowanie zakażenia C. pneumoniae u dzieci 
z zaburzeniami odporności. Infekcję potwierdzono u 71 % dzieci bez wcześniejszych 
obciążeń zdrowotnych. 
Nie stwierdzono specyficznych dla zakażenia C. pneumoniae zmian w badaniu 
radiologicznym płuc. Nie obserwowano również częstszego występowania objawów 
spoza układu oddechowego w porównaniu z dziećmi z zakażeniem innym czynnikiem 
etiologicznym. 
W analizie stężenia białka C-reaktywnego wykazano różnice pomiędzy grupami 
, 
dzieci z potwierdzonym zakażeniem C. pneumoniae (Z) i niezakażonych (NZ). Srednia 
wartość CRP w grupie Z wynosiła 14,4mg/l, a w grupie NZ 28, 1 mg/l, mediana 
odpowiednio 5,0 mg/l i 9,0 mg/l. 
W ocenie skuteczności leczenia 34 pacjentów z potwierdzonym zakażeniem 
C. pneumoniae wykazano, że antybiotyk makrolidowy zastosowano u 14 dzieci (41 %). 
Wśród dzieci, u których nie podjęto leczenia antybiotykiem celowanym, a mImo 
to uzyskano ustąpienie objawów, 80% stanowili pacjenci z zapaleniem płuc. 
Analizę okresu po zakończonej hospitalizacji, przeprowadzono u 23 dzieci 
z grupy Z i u 22 z 23 badanych dzieci (96%) wykazano eliminację C. pneumoniae. 
Dokonano oznaczeń ilościowych wybranych cytokin (IFNy, IL-1
, TNFa 
i IL-10) z zastosowaniem testów ELISA wysokiej czułości. Uzyskane wyniki sugerują, 
iż rozwój ostrego zakażenia C. pneumoniae u dzieci jest związany znadekspresją 
odpowiedzi cytokinowej typu Th2 wobec Th1, wyrażającej się znacznie wyższą 
produkcją IL-10 wobec sekrecji IFN-y. W ostrym zakażeniu C. pneumoniae dochodzi 
do umiarkowanej nadprodukcji IL-1
. Z kolei zdrowienie wraz z towarzyszącą 


113
		

/p0114.djvu

			eliminacją patogenu wydaje się być determinowane zwiększonym wytwarzaniem IFN-y 
i TNF-a. 
U dzieci ze stwierdzonym zakażeniem C. pneumonlae dokonano oznaczeń 
wykładników gospodarki lipidowej: cholesterolu całkowitego, frakcji HDL, LDL oraz 
TG. Wykazano jednak, że wszystkie analizowane parametry spełniały kryteria wartości 
referencyj n ych. 
Na podstawie analizy danych uzyskanych w niniejszej pracy stwierdzono, 
ze zakażenie C. pneumoniae jest częste w populacji dzieci i może być czynnikiem 
etiologicznym stanu zapalnego zarówno w górnym jak i dolnym odcinku układu 
oddechowego. Patogen ten stanowi istotny czynnik infekcyjny u dzieci młodszych. 


114
		

/p0115.djvu

			8. SUMMARY 


Respiratory tract infections belong to the most frequent children diseases. In Poland 
there is still lack of precise epidemiological data concerning both the rate of the 
infection occurrence and respective etiological agents. 
Chlamydophila pneumoniae is an obligatory intracellular atypical pathogen, 
which plays an important role in respiratory tract infections. The microorganism was 
considered a cause of acute diseases, but currently it also attracts attention as an 
etiological agent of chronic infections and their sequela. 
It is suggested that in the C. pneumoniae pathogenesis of infection pro- 
inflammatory and anti-inflammatory cytokines play a significant role, especially IFNy, 
which is probably related to the elimination of the infection. Moreover the pathogen 
may take part in atherogenesis, as an important risk factor of atherosclerosis. 
Recently it is more often considered, that infections caused by atypical 
pathogens, are not associated with the distinctive clinical process or typicallaboratory 
and radiological results. Variable data related to the occurrence rate of infection caused 
by C. pneumoniae, especially in children, are associated with the lack of the diagnostic 
method standardization. Nowadays it is suggested to combine molecular biology 
methods with serological analysis. 
In the presented dissertation 202 children were examined (128 boys and 74 girls) 
at the age of 2 months to 16 years, hospitalized because of respiratory tract infections. 
In order to confirm C. pneumoniae infection, from alI children swab of the pharynx 
posterior wall was taken and nested-PCR was applied. DNA C. pneumoniae presence 
was verified in 34 (17 %) of 202 examined children. 47% of the infected group were 
represented by infants, and infection frequency was significantly higher than for the 
preschool children. In 16 (26%) of 62 examined infants C. pneumoniae infection was 
confirmed. In case of 2- and 3-year-old children, infection was confirmed in 10 (18%) 
of 56 patients, that were examined. 29% of the infected group consisted of smalI 
children, without any significant differences of frequency in comparison to infants. 
Received results suggest that C. pneumoniae is commonly occurred pathogen in the 
youngest children with the upper and lower respiratory tract infections. Thus the 
microorganism should be taken into consideration in every age group patient 
diagnostics, also the youngest ones. 


115
		

/p0116.djvu

			In 28 of 34 children with the C. pneumoniae infection, confirmed by nested- 
PCR, ElA technique was applied for single determination of specific 
anti-C. pneumoniae immunoglobulins in A, M and G classes. Between molecular 
biology method results and serological analysis no correlation was demonstrated. On 
the basis of serological analysis acute infection in any of the examined child was not 
proven. For the results interpretation it is important to remember that 76% of children, 
with the confirmed by nested-PCR C. pneumoniae infection, while examined, were 
below 3 years old. It is suggested that positive results of serological analysis in this age 
group appear rarely. Presence of C. pneumoniae infection was more often demonstrated 
in children with immunity disorders. The infection was confirmed in 71 % of children 
without any earlier health disturbances. 
Radiological lungs examination did not indicate any changes which are 
particular for C. pneumoniae infection. Symptoms from outside of respiratory tract, 
in comparison to the children infected with another etiological agent, were not 
observed. 
In C-reactive protein concentration analysis, the differences between children 
group with confirmed C. pneumoniae infection (Z) and without infection (NZ), were 
demonstrated. Average CRP value in Z group was 14,4mg/l, in NZ group was 28, 1 mg/l, 
median respectively 5,0 mg/l i 9,0 mg/l. 
In evaluation of the treatment efficacy in 34 patients with confirmed 
C. pneumoniae infection, it was revealed that macrolide antibiotic was administered to 
14 children (41 %). Among children without guided antibiotic therapy, but with the 
obtained symptoms elimination, 80% were patients with pneumonia. 
The period of time after the hospitalization was analyzed in 23 children from 
group Z, and in 22 of 23 (96%) examined children elimination of C. pneumoniae was 
demonstrated. 
Quantity analysis of chosen cytokines (IFNy, IL-1
, TNFa and IL-10) was made 
by high sensitivity ELISA tests. Received results indicate that development of acute 
C. pneumoniae infection in children is related to an overexpression of the cytokine 
response type Th2 to Th 1, which is demonstrated by a significantl y higher IL-10 
production to IFN -y secretion. During acute C. pneumoniae infection moderate IL-1 
 
overproduction was observed. Recovery with associated pathogen elimination seems to 
be determined by higher IFN-y and TNF-a production. 


116
		

/p0117.djvu

			In children with confirmed C. pneumonlae infection exponents of the lipid 
metabolism were analyzed: total cholesterol, HDL and LDL fractions, and TG. 
However, it was demonstrated that alI the analyzed parameters fit into the criteria of the 
reference values. 
In the presented dissertation, on the basis of the obtained data analysis it was 
established, that C. pneumoniae infection is frequent in children population and it might 
be an etiological agent of the upper and lower respiratory tract infections. This pathogen 
is considered also as a significant infectious agent in younger children. 


117
		

/p0118.djvu

			9. PIŚMIENNICTWO 


1. Aggarwal B.B., Natarajan K.: Tumor necrosis factors: developments during last 
decade. Eur Cytokine Netw 1996; 7: 93-124. 
2. Aggarwal B.B.: Tumor necrosis factors: TNF-a and TNF-
 their structure and 
pleiotropic biological effects. Drugs of the Future 1987; 12: 891-898. 
3. Angielski S., Jakubowski Z., Dominiczak M.H.: Biochemia kliniczna. Perseusz 
Gdańsk 1997. 
4. Bartkowiak-Emeryk M., Emeryk A.: Chlamydia w zakażeniach układu 
oddechowego u dzieci. W : Mycoplasma pneumoniae i Chlamydia pneumoniae w 
zakażeniach dróg oddechowych i chorobach obturacyjnych płuc. pod red. Andrzeja 
Emeryka Medycyna Praktyczna Kraków 2001: 49-57. 
5. Baumert J., Schmidt K.H., Eitner A. i wsp. : Host CelI Cytokines Induced by 
Chlamydia pneumoniae Decrease the Expression of Interstitial Collagens and 
Fibronectin in Fibroblasts. Infect and Immun 2009; 77(2): 867-876. 
6. B e att y W.L., Byrne G.I., Morrison R.P.: Morphologic and antigenic 
characterization of interferon gamma - mediated persistent C. trachomatis 
infection in vitro. Microbiol1993; 90: 3998-4002. 
7. Belland R.J., Ouellette S.P., Gieffers S. i wsp.: Chlamydia pneumoniae and 
atherosclerosis. CelI Microbiol 2004; 6: 117-127. 
8. Blasi F.: Atypical pathogens and respiratory tract infections. Eur Respir J 2004; 24: 
171-181. 


9. Blasi F., Cosentini R., Schoeller M.C.: Chlamydia pneumoniae seroprevalence in 
immunocompetent and immunocompromised populations in Milan. Thorax 1993; 
48: 1261-1263. 


10. Blasi F., Tarsia P., Aliberti S.: Chlamydophila pneumoniae. Clin Microbiol Infect 
2009; 15: 29-35. 
11. Block S., Hedrick J., Hammerschlag M.R. i wsp.: Mycoplasma pneumoniae and 
Chlamydia pneumoniae in pediatric community-acquired pneumonia: comparative 
efficacy and safety of clarithromycin vs. erythromycin ethylsuccinate. Pediatr 
Infect Dis J 1995; 14: 471-477. 
12. Block S., Hammerschlag M., Hedrick J. i wsp.: Chlamydia pneumoniae in acute 
otitis media. Pediatr Infect Dis 1997; 16: 858-862. 
13. Boman J., Soderberg S., Forsberg J. i wsp.: High Prevalence of Chlamydia 
pneumoniae DNA in Peripheral Blood Mononuclear Cells in Patients with 
Cardiovascular Disease and in Middle-Aged Blood Donors. J Infect Dis 1998; 
178: 274-277. 


14. Brade H.: Chlamydiallipopolysaccharide. In: Endotoxin in Health Disease. Edited 
by: Brade H., Opal SM., Vogel SN, Morrison DC. Marcel Dekker Inc. New York, 
USA/Basel, Switzerland 1999; 229-242. 
15. Buja L.M.: Does atherosclerosis have an infectious etiology? Circulation 1996,94: 
872-873. 


118
		

/p0119.djvu

			16. Burney P., Forsey T., Darougar S. i wsp.: The epidemiology of Chlamydia 
pneumoniae infections in childhood: a serological investigation. Int J Epidemiol 
1984; 13: 491-495. 
17. Bush R.M., Everett K.D.E.: Molecular evolution of the Chlamydiaceae. Int J Syst 
Evol Microbiol2001; 51: 203-220. 
18. Byrne G.: Chlamydia pneumoniae and atherosclerosis: links to the disease process. 
Am Heart J 1999; 138: 488-490. 
19. Byrne G.L., Ouellette S.P., Wang Z. i wsp. : Chlamydia pneumoniae expresses 
genes required for DNA replication but not cytokinesis during persistent infection 
of Hep-2 cells. Infect Immun 2001; 69: 5423-5429. 
20. Cambell L.A., Kuo C.C., Wang S. i wsp.: Serological response to Chlamydia 
pneumoniae infection. J Clin Mirobiol1990; 28: 1261-1264. 
21. Campbell L.A., Kuo C.C.: Chlamydia pneumoniae - an infectious risk factor for 
atherosclerosis. Nat Rev Microbiol 2004; 2: 23-32. 
22. Cannon C., Braunwald E., McCabe C. i wsp.: Antibiotic Treatment of Chlamydia 
pneumoniae after Acute Coronary Syndrome. N. Engl. J. Med. 2005; 352: 1646- 
1654. 


23. Chmielewska-Szewczyk D.: Choroby infekcyjne układu oddechowego u dzieci. 
Via Medica. Gdańsk 2002. 
24. Choi T.Y., Kim D.A., Kim S.K. i wsp.: Prevalence of Specific Antibodies to 
Chlamydia pneumoniae in Korea. J Clin Microbiol1998; 36(11): 3426-3428. 
25. Chopra I., Storey C., Falla T.J. i wsp.: Antibiotics, peptidoglycan synthesis and 
genomics: the chlamydial anomaly revisited. Microbiology 1998; 144: 2673-2678. 
26. Choroszy-Król I., Furmańczyk K., Frej-Mądrzak M. i wsp.: Wykrywanie 
antygenów Chlamydia pneumoniae, przeciwciał klasy IgG oraz genu ompA u 
dzieci z przerostem migdałka gardłowego. Family Medicine Primery Care Review 
2008; 10: 11-16. 
27. Coombes B.K., Mahony J.B.: Identification of MEK- and phosphoinositide 3- 
kinasedependent signalling as essential events during Chlamydia pneumoniae 
invasion of HEp2 cells. Cellular Microbiology 2002; 4(7): 447-460. 
28. Coote N., Craig P., McKenzie S. i wsp.: BTS Standards of Care Comittee. Thorax 
2002; 57 (supLl): 1-24. 
29. Cosentini R., Tarsia P., Canetta C. i wsp.: Severe astma exacerbation: role of acute 
infection Chlamydophila pneumoniae and Mycoplasma pneumoniae infection. 
Respiratory Research 2008; 9: 48-51. 
30. Cuhna B.A, Ortega A.M.: Atypical pneumonias. Postgrad. Med. 1991; 90: 89-101. 
31. Cuhna B.A. Empiric Therapy Based on Clinical Symptom. W: Antibiotic 
Essential. Physicians Press a Sivision of Jones and Bartlett Publishers, Sundbery, 
Massachusetts 2009: 51. 
32. Cunha B.A.: The atypical pneumonias: clinical diagnosis and importance. Clin 
Microbiol Infect. 2006; 12 (SuppI3):12-24. 


119
		

/p0120.djvu

			33. Cunningham AF., Johnson SL., Julious SA. i wsp.: Chronic Chlamydia 
pneumoniae infection and asthma exacerbations in children. Eur Respir J 1998; 11: 
345-349. 


34. Dal Molin G., Longo B., Not T. i wsp.: A population based seroepidemiological 
survey of Chlamydia pneumoniae infections In schoolcholdren. J ournal of Clinical 
Pathology 2005; 58: 617-620. 
35. DanieIs S.R., Greer F.R. i wsp.: Committee on Nutrition. Lipid screening and 
cardiovascular health in childhood. Pediatrics 2008; 122: 198-208. 
36. Davidson M., Kuo C.C., Middaugh J.P. i wsp.: Confirmed previous infection with 
Chlamydia pneumoniae (TW AR) and its presence in early coronary 
atherosclerosis. Circulation 1998; 98: 628-33. 
37. Dembińska-Kieć A., Naskalski J. i wsp. Diagnostyka laboratoryjna z elementami 
biochemii klinicznej. Urban & Partner Wrocław 2002. 
38. Dembińska-Kieć A., Partyka Ł., Polus A.: Miażdżyca procesem 
autoimmunologicznym? Przegl. Lek. 2001; 58: 12-16. 
39. Denesh J., Collins R., Peto R.: Chronic infections and coronary heart disease: is 
there a link? Lancet 1997; 350: 430-436. 
40. Deptuła W., Pawlikowska M., Travanicek M.: Nowe dane na temat systematyki 
chlamydii. Post Mikrobiol. 2002, 41, 1: 71-83. 
41. Dinarello C.A.: Interleukin-1 and interleukin-1 antagonism. Blood 1991; 77: 1621- 
1652. 


42. Dowell S.F., Peeling R.W., Boman J. i wsp.: Standardizing Chlamydia 
pneumoniae Assays: Recommendations from the Centers for Disease Control and 
Prevention (USA) and the Laboratory Centre for Disease Control (Canada). Clin 
Infect Dis 2001; 33: 492-503. 
43. Eickhoff M., Thalmann J., Hess S. i wsp.: Host CelI Responses to Chlamydia 
pneumoniae in Gamma Interferon- Induced Persistence Overlap Those of 
Productive Infection and Are Linked to Genes Involved in Apoptosis, CelI Cycle 
and Metabolism. Infect and Immun 2007; 75 (6): 2853-2863. 
44. Einarsson S., Sigurdsson H.K., Magnusdottir S.D. i wsp.: Age Specific Prevalence 
of Antibodies against Chlamydia pneumoniae in Iceland. Scandinavian J ournal of 
Infection Diseases 1994; 26: 393-397. 
45. Ekman M.R., Greyston J.T., Visakorpi R. i wsp.: An Epidemic of Infections Due to 
Chlamydia pneumonia in Military Conscripts. Clinic Infect Disease 1993; 17 (3): 
420-425. 


46. Esposito S., Blasi F., Bellini F. i wsp.: Mycoplasma pneumoniae and Chlamydia 
pneumoniae infections In children with pneumonia. Eur Respir J 2001; 17: 241- 
245. 


47. Esposito S., Blasi F., Bosis S. i wsp.: Aetiology of acute pharyngitis: the role of 
atypical bacteria. J Med Microbiol2004; (53): 645-651. 
48. Esposito S., Blasi F., Popescu I. i wsp.: Nasopharyngeal Carriers of Chlamydia 
pneumoniae In Children with Reccurent Respiratory Tract Infection and Healthy 
Subject. Abstr Intersci Conf Antimicrob Agents Chemother 2000 Sep 17-20; 40: 
439. 


120
		

/p0121.djvu

			49. Esposito S., Bosis S., Faeli N. i wsp.: Role of Atypical bacteria and Azythromycin 
Therapy for Children With Recurrent Respiratory Tract Infection. Pediatr Infect 
Dis J 2005; 24(5): 438-444. 
50. Everett K.D.E., Andersen A.A.:ldentification of nine species of the Chlamydiaceae 
using PCR-RFLP. Int J Syst Bacteriol1999; 49: 803-813. 
51. Everett K.D., Bush R.M., Andersen A.A.: Emended description of the order 
Chlamydiales, proposal of Parachlamydiales fam. nov. each containing one 
monotypic genus, revised taxonomy of the family Chlamydiaceae, including new 
genus and five new species and standards for the identification of organisms. Int J 
Syst Bacteriol1999; 49: 415-440. 
52. Falc G., Engstrand I., Gnarpe J. i wsp. Association of Chlamydia pneumonia with 
Otitis Media in Children. Scandinavian Journal of Infection Diseases 1998; 30(4): 
377-380. 


53. Falck G., Gnarpe J., Gnarpe H.: Prevalence of Chlamydia pneumoniae in healthy 
children and in children with respiratory tract infections. Pediatr Infect Dis J. 1997; 
16(6): 549-54. 
54. Falsey A.R., Walsh E.E.: Transmision of Chlamydia pneumoniae. J Infect Dis 
1993; 168 (2): 493-496. 
55. File T.M. Jr., Tan J.S.: Chlamydia pneumoniae pneumonia. Semin Respir Crit Care 
Med 2000; 21: 285-294 
56. Futterman L.G., Lemberg L.: Fifty percent of patients with coronary heart disease 
do not have any of conventional risk factors. Am J Crit Care 1998; 7: 240-244. 
57. Garrity G.M.: Bergey's Manual of Systematic Bacteriology; Springer, USA 2005. 
58. Gaydos C.A., Fowler C.L., GilI V.J.: Detection of Chlamydia pneumoniae by 
Polymerase Chain Reaction-Enzyme Immunoassay in an Immunocompromised 
Population. Clin Infect Dis 1993; 17: 718-723. 
59. Gerard H., Schumacher R., EI-Gabalawy H. i wsp.: Chlamydia pneumoniae 
present in the human synovium are viable and metabolically active. Microbial 
Pathogenesis 2000; 29: 17-24. 
60. Gieffers J., Pohl D., Treib J. i wsp.: Presence of Chlamydia pneumoniae DNA in 
the cerebral spinal fluid is a common phenomenon in a variety of neurological 
diseases and not restricted to multiple sclerosis. Ann Neuro12001; 49: 585-589. 
61. Gieffers J. Reusche E., Solbach W. i wsp. Failure To Detect Chlamydia 
pneumoniae in Brain Sections of Alzheimer's Disease Patients. J Clin Microbiol 
2000; 38: 881-882. 
62. Gieffers J., Rupp J., Gebert A. i wsp.: First-choice antibiotics at subinhibitory 
concentrations induce persistence of Chlamydia pneumoniae. Antimicrob Agents 
Chemother 2004; 48: 1402-1405. 
63. Giffers J., FulIgraf H., Jahn J. i wsp.: Chlamydia pneumoniae infection in 
circulating human monocytes is refractory to antibiotic treatment. Circulation 
2001; 103: 351-356. 


64. Goo YA., Horis M., Voorhies J. i wsp. Failure to detect Chlamydia pneumoniae in 
ear fluids from children with otitis media. Pediatr Infect Dis J 1995; 14: 1000- 
1001. 


121
		

/p0122.djvu

			65. Górny D., Wróbel J. Termoregulacja. W: Patofizjologia dla studentów medycyny, 
red Maśliński S., Ryżewski J., Wydawnictwo Lekarskie PZWL Warszawa 1998. 
66. Grayston J.T., Diwan V.K., Cooney M. i wsp.: Community- and hospital-acquired 
pneumonia associated with Chlamydia TW AR infection demonstrated 
serologically. Arch Intern Med. 1989; 149(1): 169-73. 
67. Grayston J.T., Kuo C.C., Campbell L.A. i wsp.: Chlamydia pneumoniae sp. nov. 
for Chlamydia sp. strain TW AR. Int J Syst Bacteriol 1989; 39: 88-90. 
68. Grayston J.T., Wang S.P., Kuo C.C. i wsp.: Current knowledge on Chlamydia 
pneumoniae, strain TW AR, an important cause of pneumonia and other acute 
respiratory diseases. Eur J Clin Microbiol Infect Dis 1989; 8: 191-202. 
69. Grayston JT.: Chlamydia pneumoniae, strain TW AR pneumonia. Annu Rev Med 
1992; 43: 317-23. 
70. Graystone J.T.: Background and current knowledge of Chlamydia pneumoniae and 
atherosclerosis. J Infect Dis 2000; 181: 402-410. 
71. Graystone J.T.: A new respiratory tract pathogen: Chlamydia pneumoniae strain 
TW AR. J Infect Dis 1990; 161,618-625. 
72. Hagiwara K., Ouchi K., Tashiro N. I wsp.: An epidemic of a pertussis-like illness 
caused by Chlamydia pneumoniae. Pediatr Infect Dis J 1999; 18: 271-275. 
73. Hahn D.L., Aenabor A.A., B e att y W.L. i wsp.: Chlamydia pneumoniae as a 
respiratory pathogen. Front Biosci 2002; 7: 66-76. 
74. Hahn D.L.: Chlamydia pneumonia, asthma, and COPD: what is the evidence? Ann 
Allergy Immunol. 1999; 83(4): 271-288. 
75. Hammerschlag M.R. Chlamydia pneumoniae and the lung. Eur Respir J 2000; 16: 
1 00 1 - 1 007 . 


76. Hatch P.T.: Disulfide cross-linked envelope proteins: the functional equivalent of 
peptidoglycan in Chlamydiae? J Bacteriol1996; 178: 1-5. 
77. Hedayat D., Jebeli M., Mandegar M. i wsp.: Związek pomiędzy Chlamydia 
pneumoniae w blaszkach miażdżycowych a czynnikami ryzyka rozwoju choroby 
wieńcowej u chorych poddawanych rewaskularyzacji chirurgicznej. Kardiol Pol 
2009; 67: 981-986. 


78. Heiskanen-Kosma T., Korppi M., Laurila A. i wsp.: Chlamydia pneumoniae is an 
Important Cause of Community-acquired Pneumonia in School-aged Children: 
Serological Results of a Prospective, Population-based Study. Scand J Infect Dis 
1999; 31: 255-259. 


79. Hertzen L.C.: Role of persistent infection in the control and severity of asthma: 
focus on Chlamydia pneumonia. Eur Respir J 2002; 19: 546-556. 
80. Holt J.G., Krieg N.R., Sneath P.H.A. i wsp.: The Rikettsies and Chlamydias. W: 
Bergey's manual of determinative bacteriology. Williams & Wilkins, Baltimore 
1994; 351-352. 


81. Hryniewicz W., Ozorowski T., Radzikowski A. i wsp. Rekomendacje 
postępowania w pozaszpitalnych zakażeniach układu oddechowego. Narodowy 
Instytut Leków Warszawa 2010. 


122
		

/p0123.djvu

			82. Hummel M., Hofueinz R., Buchheidt D.: Severe Chlamydia pneumoniae infection 
in a patient with mild neutropenia during treatment of Hodgkins disease. Ann 
Hematol2004; 83: 441-443. 
83. Hvidsten D., Halvorsen D.S., Berdal B.P. i wsp.: Chlamydophila pneumoniae 
diagnostics: importance of methodology in relation to timing of sampling. Clin 
Microbiol Infect 2009; 15: 42-49. 
84. Hyman C.L., Roblin P.M., Gaydos C.A.: Prevalence of asymptomatic 
nasopharyngeal carriage of Chlamydia pneumoniae in subjectively healthy adults: 
assessment by polymerase chain reaction-enzyme immunoassay and culture. Clin 
Infect Dis. 1995 May; 20(5): 1174-8. 
85. Ikezawa S.: Prevalence of Chlamydia pneumonia in acute respiratory tract 
infection and detection od anti-Chlamydia pneumonia specific IgE in Japanese 
children with reactive airway disease. Kurume Med J 2001; 48(2): 165-170. 
86. Ivanova L., Yankov K., Bojkova K. i wsp.: The role of atypical pathogens in 
community-acquired pneumonia. Biotechnol. Eq. 2005; 19: 147-149. 
87. Iwańczak F., Stawarski A., Iwańczak B .: Ocena obrazu klinicznego atypowych 
zapaleń płuc wywołanych przez Mycoplasma pneumoniae i Chlamydia sp. u 
dzieci. Wiad Lek 2001; 1-2: 26-37. 
88. Jahnz-Różyk K.,Targowski T. Jurkiweicz D.: Bakterie atypowe w zakażeniach 
dróg oddechowych-patogeneza i diagnostyka. Pol. Merk. Lek. 2008, XXV,149, 
412-414. 


89. Jakóbisiak M.: Immunologia. Wydawnictwo Naukowe PWN Warszawa 2000. 
90. Jantos C.A., Wienpahl B., Schiefer H.G. i wsp.: Infection with Chlamydia 
pneumoniae in infants and children with acute lower respiratory tract disease. 
PediatrlnfectDisJ 1995; 14: 117-122. 
91. Jiang S.I., Kuo C.C., Berry M. i wsp.: Identification and Characterization of 
Chlamydia pneumoniae - Specific Proteins That Activate Tumor Necrosis Factor 
Alpha Production in RA W 264.7 Murine Macrophages. Infect and Immun 2008; 
76(4): 1558-1564. 
92. Joensena J., Juul S., Henneberg E. i wsp. Can long-term antibiotic treatment 
prevent progression of peripheral arterial occlusive disease? A large, randomized, 
double-blinded, placebo-controlled trial. Arteriosclerosis 2008; 196: 937-942. 
93. Kabra S.K., Lodha R., Broor S. i wsp.: Etiology of acute lower respiratory tract 
infection. Indian J Pediatr 2003; 70: 33-36. 
94. Kalman S., Mitchell W., Marathe R. i wsp.: Comparative genomes of Chlamydia 
pneumoniae and C. trachomatis. Nature Genetics 1999; 21: 385-389. 
95. Kato A., Takita T., Maruyama Y. i wsp.: Chlamydia infection and progresion of 
carotid atherosclerosis In patient on regular haemodialysis. Naphrol Dial 
Transplant 2004; 19: 2539-2546. 
96. Kauppinen M.T., Saikku P., Kujala P. i wsp.: Clinical picture of community- 
acquired Chlamydia pneumoniae pneumonia requiring hospital treatment: a 
comparison between chlamydial and pneumococcal pneumonia. Thorax 1996; 51: 
185-189. 


123
		

/p0124.djvu

			97. Kern J.M., Maas V., Maas M.: Molecular pathogenesis of chronic Chlamydia 
pneumoniae infection: a brief overview. Clin Microbiol Infect 2009; 15: 36-41. 
98. Knaupinen M., Saikku P.: Pneumonia due to Chlamydia pneumoniae: Prevalence, 
Clinical Features, Diagnosis and Treatment. Clin InfDisease 1995,21: 244-252. 
99. Knudsen K., Madsen, A.S., Mygind, P. i wsp.: Identification of two novel genes 
encoding 97- to 99-kilodalton outer membrane protein s of Chlamydia 
pneumoniae. Infect Immun 1999; 67: 375 - 383. 
100. Kozioł-Montewka M.: Drogi oddechowe jako wrota zakażeń - interakcje 
gospodarz-patogen. Now Med 2009; 1: 3-7. 
101. Kuo C., Campbell LA.: Detection of Chlamydia pneumoniae in arterial tissues. J 
Infect Dis 2000; 181 (3): 432-6. 
102. Kuo C.C., Jackson L.A., Campbell L.A. I wsp: Chlamydia pneumoniae (TW AR). 
Clin Microbiol Rev 1995; 8: 451-461. 
103. Kuo C.C., Grayston J.T., Campbell L.A. i wsp.: Chlamydia pneumoniae (TW AR) 
in coronary arteries of young adults (15-34 years old). Proc Natl Acad Sci USA 
1995; 92: 6911-4. 
104. Kutlin A., Flegg C., Stenzel D. i wsp.: Ultrastructural study of Chlamydia 
pneumoniae in a continous-infection model. J Clin Microbiol 2001; 39: 3721-3723. 
105. Kwon T.W., Kim D.K., Ye J.S. i wsp.: Detection of Enterovirus, Cytomegalovirus, 
and Chlamydia pneumoniae in Atheromas. J Microbiol2004: 299-304. 
106. Łącki J.K., Wiktorowicz K.E.: Biologiczne właściwości interleukiny 10. Post Hig 
Med Dosw 1994; 4: 363-370. 
107. Laurila A., Bloigu a., Nayha S. i wsp.: Chronic Chlamydia pneumoniae Infection 
Is Associated With a Serum Lipid Profile Known to Be a Risk Factor for 
Atherosclerosis. Atherioscler Thromb Vasc Bio11997; 17: 2910-2913. 
108. Layh-Schmitt G., Bendl C., Hildt U. i wsp.: Evidence for infection with Chlamydia 
pneumoniae in a subgroup of patients with multiple sclerosis. Ann Neurol 2001; 
47: 652-655. 


109. Mac Neil J.A., Suda T., Moore K.W. I wsp: IL-10, anovel cofactor for mature T 
cells. J Immunol. 1990; 145: 4167-4173. 
110. Malski M., Chomicz L., Dąbrowska L. i wsp.: Chlamydia pneumoniae - groźny 
czynnik biologiczny współodpowiedzialny za patologiczne zmiany w ścianach 
tetnic ludzkich w procesach miażdżycowych. Przegl Epidemiol 2003; 57: 255-262. 
111. McConnochie K.M., Hall C.B., Barker W.H.: Lower respiratory tract illness in the 
first two years of life: epidemiologic patterns and costs in a suburban pediatric 
practice. Am J Public Health. 1988; 78(1): 34-9. 
112. Mclntosh K.: Community-Acquired Pneumonia in Children. N Engl J Med 2002; 
346: 429-437. 


113. Michelow I., Olsen K., Lozano J. i wsp.: Epidemiology and Clinical 
Characteristics of Community-Acquired Pneumonia in Hospitalized Children. 
Pediatrics 2004; 113: 701-707. 


124
		

/p0125.djvu

			114. Mills G., Lindemann J., Fawcett J. i wsp.: Chlamydia pneumoniae serological 
status is not associated with asthma in children or young adults. Int J Epidemiol 
2000; 29: 280-284. 
115. Moore K., O'Garra A., De Waal-Malefty R. i wsp.: Interleukin-10. Ann Rev 
Immunol1993, 11: 165-190. 
116. Mosmann T.R. and Sad S. The expanding universe of T-celI subsets: Th1, Th2 and 
more. Immunol Today, 1996; 17: 142-146. 
117. Moulder I.W.: Interaction of Chlamydiae and host cells in vitro. Microbiol Rev 
1991; 55: 143-190. 
118. Murphy T., Henderson F., Clyde W. i wsp.: Pneumonia: an eleven-year study in a 
pediatric practice. Am J Epidemiol 1981; 113 (1): 12-21. 
, 
119. Murray L.J., O Reilly D.P., Ong G.M. i wsp.: Chlamydia pneumoniae antibodies 
are associated with an atherogenic lipid profile. He art. 1999; 81 (3): 239-244. 
120. Nitsch-Osuch A., Choroszy-Król I., Teryks-Wołoniec D.: Zapalenia płuc 
wywołane przez Chlamydia trachomatis i Chlamydia pneumoniae u dzieci z 
wrodzonymi wadami serca. Klin Chor Zak 2000; 4; 9-14. 
121. Normann E., Gnarpe J., Gnarpe H. i wsp.: Chlamydia pneumoniae infection predict 
a reduced risk for subsequent atopic disease. Acta Paediatr 2005; 94: 705-710. 
122. Normann E., Gnarpe J., Gnarpe H. i wsp.: Chlamydia pneumoniae in children 
attending day-care centers in Gtivle, Sweden. Pediatr Infect Dis J 1998; 17(6): 474- 
478. 


123. Normann E., Gnarpe J., Gnarpe H. i wsp.: Chlamydia pneumoniae in children with 
acute respiratory tract infections. Acta Pediatr 1998 ; 87: 23-7. 
124. Normann E., Gnarpe J., Naas J. i wsp.: Chlamydia pneumoniae In children 
undregoing adenoidectomy. Acta Pediatr 2001; 2: 126-129. 
125. Nowaczyk P., Deptuła w.: Chlamydophila pneumoniae - biotyp TW AR - 
wybrane dane. Postepy Hig Med Dosw 2006; 60: 609-616. 
126.0'Connor C., Dunne M., Marc A. i wsp.: Azithromycin for the Secondary 
Prevention of Coronary Heart Disease Events. The WIZARD Study: A 
Randomized Controlled Trial. JAMA 2003; 290: 1459-1466. 
127. O'Garra A. Cytokines induce the development of functionally heterogenous T 
helper celI subsets. Immunity 1998; 8: 275-283. 
128. Ogawa H., Hashiguchi K., Kazuyama Y.: Recovery of Chlamydia pneumoniae, in 
six patient with otitis media with effusion. J Laryngol Oto11992; 106: 490-492. 
129. Omur A., Okan G., Nihal M. i wsp. :Chlamydia pneumoniae arthritis in a patient 
with common variable immunodeficiency. Ann Allergy Asthma Immunol 2005; 
94: 504-508. 


130. Parthasarthy S., Barnett J., Fong L.: High density lipoproteins inhibits the 
oxidative modification of low density lipoproteins. Bioch Biophys Acta 1990; 
1044: 275-283. 


131. Peter s J., Wilson D.P., Myers G. i wsp. : Type III secretion a la Chlamydia. Trends 
Microbiol2007; 15: 241-245. 


125
		

/p0126.djvu

			132. Pioruńska-Stolzmann M., Batko J., Majewski W.: Lipid profile, lipase and 
glutathione peroxidase activities in the serum of patients with atherosclerosis. Med 
Sci Monit 1999,5: 900-903. 
133. Podsiadły E., Frącka B., Szmigielska A. i wsp.: Seroepidemiologiczne badania 
zakażeń Chlamydia pneumoniae u dzieci w wieku 1-36 m.ż. z zapaleniem dróg 
oddechowych i innymi chorobami w Polsce. Pol. J. Microbiol., 2005; 3: 215-219. 
134. Podsiadły E., Tylewska-Wierzbanowska S.: Czy Chlamydophila pneumoniae może 
być czynnikiem etiologicznym chorób nieinfekcyjnych. Post Microbiol 2005; 44: 
127-136. 


135. Pożarowski P., Roliński J.: Rola odpowiedzi immunologicznej w infekcjach 
układu oddechowego wywołanych bakteriami żyjącymi wewnątrz komórek. W: 
Mycoplasma pneumoniae i Chlamydia pneumoniae w zakażeniach dróg 
oddechowych i chorobach obturacyjnych płuc. pod red. Andrzeja Emeryka 
Medycyna Praktyczna Kraków 2001: 22-28. 
136. Principi N., Esposito S., Blasi F. i wsp.: Role of Mycoplasma pneumoniae and 
Chlamydia pneumoniae in children with community-acquired lower respiratory 
tract infection. Lower respiratory tract infection. Clin Infect Dis 2001; 32(9): 1281- 
1289. 


137. Rachelefsky G. S., Liao Y., Faruqi R.: Impact of inhaled corticosteroid-induced 
oropharyngeal adverse events: results from a meta-analysis. Ann Allergy Asthma 
Immunol 2007; 98(3): 225-238. 
138. Rasmussen S.J., Eckmann S., Quayle A.J. i wsp. : Secretion of proinflammatory 
cytokines by epithelial cells in response to Chlamydia infection suggests a central 
role for epithelial cells in pathogenesis. J Clin Ivest 1997; 99: 77-87. 
139. Rattei T., Ott S., Gutacker M. i wsp.: Genetic diversity of the obligate intracellular 
bacterium Chlamydophila pneumoniae by genome-wide analysis of single 
nucleotide polymorphisms: evidence for highly clonal population structure. BMC 
Genomics 2007; 8: 355. 
140. Redecke V., Dalhoff K., Bohnet S. i wsp.: Interaction of Chlamydia pneumoniae 
and human alveolar macrophages: infection and inflammatory response. Am J 
Respir CelI Mol Bio11998; 19: 721-727. 
141. Richeldi L., Ferrara G., Fabbri L.M. i wsp. Macrolides for chronic asthma. 
Cochrane database of systematic reviews, 2007; 4, Art.NoCD002997. 
142. Robak T. Biologia i farmakologia cytokin. Wydawnictwo Naukowe PWN 
Warszawa 1995. 
143. Roblin P., Hammerschlag M.: Microbiologic Efficacy of Azithromycin and 
Susceptibilities to Azithromycin of Isolates of Chlamydia pneumoniae from Adults 
and Children with Community-Acquired Pneumonia. Antimicrob Agents 
Chemother 1998; 42: 194-196. 
144. Rockey D.D., Len art J., Stephens R.S.: Genome sequencing and our 
understanding of Chlamydiae. Infect Immun 2000; 68: 5473-5479. 
145. Romagnani S.: Type 1T helper and type 2T helper cells: functions, regulations and 
role in protections and disease. Int J Clin Lab Res 1991; 21: 152-158. 


126
		

/p0127.djvu

			146. Ross R.: The pathogenesis of atherosclerosis: a perspective for the 1990. Nature 
1993; 362: 801-809 
147. Ross R.: The pathogenesis of atherosclerosis. An update. N Engl J Med 1986; 314, 
488-500. 


148. Rottenberg, M.E., Gigliotti-Rothfuchs A., Wigzell H.: The role of IFN-gamma in 
the outcome of chlamydial infection. Curr Opin Immunol 2002; 14: 444-451. 
149. Sawayama Y., Kikuchi K., Tatsukawa M. i wsp.: Association of Chlamydophila 
pneumoniae DNA in Peripheral Blood Mononuclear Cells and IgA Antibody with 
Atherosclerotic Diseases. Fukuoka Acta Med 2009; 100(9): 305-312. 
150. Schindler R., Mancilla J., Endres S . i wsp.: Correlations and interactions in the 
production of interleukin-6 (IL-6), IL-1, and tumor necrosis factor (TNF) in human 
blood mononuclear cells. Blood 1990; 75, 40-47. 
151. Schmidt S.M., Muller C.M., Krechting M. i wsp.: Chlamydia pneumoniae Carrige 
and Infection in Hospitalized Children with Respiratory Tract Diseases. Infection 
2003; 28: 410-416. 
152. Schmidt SM., Muller CS., Gurtler L. i wsp.: Chlamydophila pneumonia respiratory 
tract infection aggravates therapy refractory bronchitis or pneumonia in childhood. 
Clin Pediatr 2005; 217(1): 9-14. 
153. Schmitz-Esser S., Linka N., Collingro A. i wsp.: ATP/ADP Translocases: a 
Common Feature of Obligate Intracellular Amoebal Symbionts Related to 
Chlamydiae and Rickettsiae. J Bacteriol2004; 186,3: 683-691. 
154. Sessa R.: Prevalence of Chlamydia pneumoniae in peripheral blood mononuclear 
cells in Italian patients with acute ischaemic heart disease. Atherosclerosis 2001; 
159(2): 521-525. 
155. Shah S., Alpern E., MD; Zwerling L. Risk of Bacteremia in Y oung Children With 
Pneumonia Treated as Outpatients, Arch Pediatr Adolesc Med. 2003; 157: 389- 
392. 


156. Shor A., Kuo C.C., Patton D.L.: Detection of Chlamydia pneumoniae in coronary 
arterial fatty streaks and atheromatous plaques. S Afr Med J 1992 ; 82(3): 158-61. 
157. Siriam S., Straton C., Yao S. i wsp.: Chlamydia pneumoniae Infection of the 
Central Nervous System in Multiple Sclerosis. Ann Neuro11999; 46: 6-14. 
158. Somer A., Salman N., Yalcin I.: Role of Mycoplasma pneumoniae and Chlamydia 
pneumoniae in children with community-acquired pneumonia in Istambul, Turkey. 
J Trop Pediatr 2006; 52(3): 173-178. 
159. Stamm W.E.: Diseases due to Chlamydia pneumoniae. ACP Medicine Online 
2002. 


160. Stępień E., Pieniążek P., Branicka A. i wsp.: Zakażenia Chlamydia pneumoniae- 
metody diagnostyczne. Przegl Lek 2001; 58: 142-146. 
161. Study Group, European Atherosclerosis Society (1987). Strategies for the 
prevention of coronary he art disease: A policy statement of the European 
Atherosclerosis Society. Eur Heart J, 8: 77. 
162. Szkaradkiewicz A.: Interleukina 1 in vivo-aspekty patogenetyczne, zastosowania 
kliniczne. Pol J Immunol1993, 3, 291-301. 


127
		

/p0128.djvu

			163. Teig N., Anders A., Schmidt C. i wsp.: Chlamydophila pneumoniae and 
Mycoplasma pneumoniae In respiratory specimens of children with chronic lung 
diseases. Thorax 2005; 60: 962-966. 
164. Tenenbaum T., Heusch A., Henrich B. i wsp.: Acute Hemorrhagic Pericarditis in a 
Child with Pneumonia Due to Chlamydophila pneumoniae. J Clin Microbiol. 2005 
January; 43(1): 520-522. 
165. Thom D.H., Grayston J.T.: Infections with Chlamydia pneumoniae strain TW AR. 
Clin Chest Med 1991; 12(2): 245-56. 
166. Tjhie J.H., Dorigo-Zetsma J.W., Roosendaal R. i wsp.: Chlamydia pneumoniae and 
Mycoplasma pneumoniae In children with acute respiratory infection In general 
practices In the Netherlands. Scand J Infect Dis 2000; 1, 13-17. 
167. Troy C., Peeling R., Ellis R.: Chlamydia pneumoniae as a New Source of 
Infectious Outbreaks in Nursing Homes. JAMA 1997; 277: 1214-1218 
168. Trumstedt C.: Innate immunity to intracellular bacterial infections. Karolinska 
Institut, Stockholm 2008. 
169. Tuuminen T., Varjo S., Ingman H.: Prevalence of Chlamydia pneumoniae and 
Mycoplasma pneumonia. Immunoglobulin G and A Antibodies in a Healthy 
Finnish Population as Analyzed by Quantitative Enzyme Immunoassays. Clin 
Diagn Lab Immunol2000; 7(5): 734-738. 
170. Verkooyen R.P., Willemse D., Hiep-van Costeren S. i wsp.: Evaluation of PCR, 
culture and serology for diagnosis of Chlamydia pneumoniae respiratory 
infections. J Clin Microbiol1998; 2301-2307. 
171. Volanen I., Raitakari O., Vainionpaa R. i wsp.: Serum Lipid Rrofiles Poor 
Correlated With Chlamydia pneumoniae, Helicobacter pylori and Cytomegalovirus 
Seropositivity in Prospectively Follow-up Healtjy Children. Atkerioscler Thromb 
Vasc Bio12005; 25: 827-832. 
172. Vora G.J., Stuart E.S.: A role for the glycolipid exoantigen (GLXA) in chlamydial 
infectivity. Curr Microbiol2003; 46: 217-223. 
173. Wangroongsarb P., Geenkajorn K., Pektkanchanapong W. i wsp.: Chlamydophila 
pneumoniae Infection among Y oung Children with Respiratory Diseases in 
Thailand Jpn J Infect Dis 2003; 56: 146-150. 
174. Ward M.: The immunobiology and immunopathology of chlamydial infections. 
AMPIS 1995; 103: 769-796. 
175. Wąsowska-Królikowska K., Funkowicz M.: Nowości w pediatrii w 2009 roku. 
Przew Lek 2009. 
176. Yamaguchi H., Friedman H., Yamamoto M. i wsp.: Chlamydia pneumoniae 
Resists Antibiotics in Lymphocytes. Antimicrob Agents Chemother. 2003; 47 (6): 
1972-1975. 


177. Yang J., Craig Hooper W., Phillips D.J. i wsp.: Induction of Proinflammatory 
Cytokines in Human Lung Epithelial Cells during Chlamydia pneumoniae 
Infection. Infect and Immun 2003; 71(2): 614-620. 
178. Yeung S.M., McLeod K., Wang S.P. i wsp.: Lack of evidence of C. pneumoniae 
infection in infants with acute lower respiratory tract disease. Eur J Clin Microbiol 
Infect Dis 1993;12: 850-853. 


128
		

/p0129.djvu

			179. Yucesan Canan, Sriram Subramaniam. Chlamydia pneumoniae infection of the 
central nervous system. Current Opinion in Neurology 2001; 14: 355-359. 
180. Zdrodowska-Stefanow B., Ostaszewska I. Chlamydia trachomatis - zakażenia u 
ludzi. Volumed, Wrocław 2000. 
181. Ziegler T., Kauppila J., Leinonen M. i wsp.: Epidemiology and Clinical 
Characteristics of Community-Acquired Pneumonia in Hospitalized Children. 
Pediatrics 2004; 113: 701-707. 


129