/p0001.djvu

			Katedra i Zakład Farmacji Fizycznej i Farmakokinetyki 
Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu 
Andrzej Czyrski 
Preparatyka, struktura, wybrane właściwości 
fizykochemiczne i biologiczne nowej pochodnej 
papaweryny 
Rozprawa doktorska 
Promotor 
Prof. dr hab. n. farm. Tadeusz W. Hermann 
Poznań 2010
		

/p0002.djvu

			Słowa kluczowe: papaweryna, związek X, związek WP, struktura, właściwości 
fizykochemiczne
		

/p0003.djvu

			Rozprawę doktorską dedykuję moim Rodzicom
		

/p0004.djvu

			Praca zrealizowana w ramach grantu promotorskiego Ministerstwa Nauki i 
Szkolnictwa Wyższego nr NN 405 178 335
		

/p0005.djvu

			Panu Prof. dr hab. Tadeuszowi Hermannowi 
za naukową opiekę, nieocenioną pomoc, 
cenne wskazówki oraz cierpliwość i życzliwość 
w trakcie realizowania pracy składam, 
Serdeczne podziękowania
		

/p0006.djvu

			Serdecznie dziękuję 
Panu Dr Ulrichowi Girreserowi 
z Pharmazeutische Institut der Christian-Albrechts-Universität 
w Kilonii (Niemcy) za wykonanie i pomoc w interpretacji widm NMR oraz za nadzór 
naukowy podczas stypendium 
Pani Prof dr hab. Elżbiecie Wyrzykiewicz 
z Uniwersytetu im. Adama Mickiewicza w Poznaniu 
za nieocenioną pomoc w interpretacji widm mas 
Pani Prof. dr hab. Marii Rybczyńskiej i dr Błażejowi Rubisiowi 
z Katedry Chemii Klinicznej i Diagnostyki Molekularnej UMiKM 
za przeprowadzanie badań cytotoksyczności i interpretację wyników 
Panu Prof. dr hab. Bernardowi Juskowiakowi 
z Uniwersytetu im. Adama Mickiewicza w Poznaniu 
za wykonanie badań powinowactwa do DNA i pomoc w interpretacji wyników 
Panu Prof. dr hab. Dariuszowi Matosiukowi i dr hab. Krzysztofowi Jóźwiakowi 
z Uniwersytetu Medycznego w Lublinie 
za merytoryczną pomoc podczas wykonywania pomiarów lipofilowości 
Wszystkim Koleżankom i Kolegom 
z Katedry Farmacji Fizycznej i Farmakokinetyki 
za życzliwość i miłą atmosferę 
w trakcie realizacji pracy
		

/p0007.djvu

			Spis treści 
____________________________ __ _ __ _ ___ _ __ _ __ _ __ __ _ __ _______________________ 
1. 
WSTĘP I CEL PRACY 
4 
2. 
CZĘŚĆ TEORETYCZNA 
5 
2.1. 
Właściwości fizykochemiczne papaweryny 
5 
2.2. 
Zastosowanie papaweryny w lecznictwie 
6 
2.3. 
Trwałość roztworów papaweryny 
9 
2.4. 
Spektroskopia NMR 
12 
2.4.1. Rys historyczny 
12 
2.4.2. Podstawy teoretyczne spektroskopii NMR 
12 
2.4.2.1. Właściwości magnetyczne jąder 
12 
2.4.2.2. Warunek rezonansu 
13 
2.4.2.3. Przesunięcie chemiczne 
14 
2.4.3. Widma NMR 
16 
2.4.3.1. Spektroskopia protonowego rezonansu magnetycznego 1H NMR 
16 
2.4.3.2. Spektroskopia rezonansu magnetycznego 13C NMR 
20 
2.4.3.3. Spektroskopia rezonansu magnetycznego 15N NMR 
22 
2.5. 
Spektrometria mas (MS) 
24 
2.5.1. Metody jonizacji w MS 
25 
2.5.2. Proces fragmentacji 
26 
2.5.3. Rodzaje jonów w MS 
27 
2.5.3.1. Jon molekularny i pik podstawowy 
27 
2.5.3.2. Jony izotopowe 
28 
2.5.3.3. Jony parzysto- i nieparzystoelektronowe 
28 
2.5.3.4. Jony metastabilne 
29 
2.6. 
Oznaczanie cytotoksyczności 
31 
2.7. 
Pojęcie lipofilowości związku 
32 
3. 
CZĘŚĆ DOŚWIADCZALNA 
35 
3.1. 
Materiały i metody 
35 
3.1.1. Odczynniki 
35 
3.1.2. Aparatura 
36 
3.1.3. Otrzymanie niektórych produktów utleniania papaweryny 
36 
3.1.3.1. Otrzymanie papawerynolu oraz chlorku 13-(3,4-dimetoksyfenylo)- 
2,3,8,9-tetrametoksy-6a,12a-diazadibenzo[a,g]fluorenyliowego (związek 
NF) -- Metoda Gadamera-Schulemanna 
36 
3.1.3.2. Synteza chlorku 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1-a]- 
izochinoliniowego (związek X) oraz jodku i heksafluorofosforanu X 
37 
3.1.3.3. Preparatyka soli wewnętrznej 2-(2-karboksy-4,5-dimetoksyfenylo)-6,7- 
dimetoksyizochinoliniowej (związek WP) 
38 
3.1.4. Badania strukturalne 
39 
3.1.4.1. Analiza elementarna 
39 
3.1.4.2. Widmo absorpcyjne UV-Vis 
39 
3.1.4.3. Widmo IR 
39 
3.1.4.4. Spektrometria mas (MS) 
40 
3.1.4.4.1. Niskorozdzielcze widmo mas (EI-MS) 
40
		

/p0008.djvu

			Spis treści 
____________________________ __ _ __ _ ___ _ __ _ __ _ __ __ _ __ _______________________ 
3.1.4.4.2. Widmo mas (ESI-MS) 
40 
3.1.4.4.3. Wysokorozdzielcze widmo mas (HREI-MS) 
40 
3.1.4.5. Jądrowy rezonans magnetyczny (NMR) 
40 
3.1.5. Optymalizacja otrzymywania nowej pochodnej (związek WP) 
41 
3.1.6. Wyznaczanie wartości pH połowicznej przemiany (pH50%) chlorku 
związku X w sól wewnętrzną 2-(2-karboksy-4,5-dimetoksyfenylo)-6,7- 
dimetoksyizochinoliniową 
42 
3.1.7. Badania rozpuszczalności w wodzie 
43 
3.1.7.1. Wyznaczenie krzywych wzorcowych związków: X, WP i NF 
44 
3.1.8. Badania lipofilowości 
44 
3.1.9. Badania aktywności biologicznej - test cytotoksyczności -- oznaczanie 
IC50 
45 
3.1.10. Oznaczanie aktywności hamowania telomerazy oraz polimerazy 
46 
3.1.11. Badanie wiązania z DNA 
46 
4. 
WYNIKI 
48 
4.1. 
Analiza struktury chlorku 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1- 
a]izochinioliniowego (związek X) 
48 
4.1.1. Analiza widma UV-Vis 
48 
4.1.2. Analiza elementarna 
49 
4.1.3. Widmo ESI-MS 
49 
4.1.4. Widmo 1H NMR 
50 
4.1.4. Widmo 13C CP NMR 
52 
4.1.4. Widmo 15N NMR 
55 
4.1.5. Widmo 13C DEPT NMR 
56 
4.1.6. Widma dwuwymiarowe 
57 
4.1.6.1. Widmo 1H,1H COSY LR NMR 
57 
4.1.6.2. Widmo 1H,13C HMBC NMR 
58 
4.1.6.3. Widmo 1H,15N HMBC NMR 
59 
4.1.6.4. Widmo 1H,13C HSQC NMR 
60 
4.2. 
Rozwiązanie struktury nieznanej pochodnej (związek WP) 
61 
4.2.1. Analiza widma UV-Vis 
61 
4.2.2. Analiza widma IR 
62 
4.2.3. Analiza elementarna 
64 
4.2.4. Analiza widm MS 
64 
4.2.4.1. Analiza widma ESI-MS 
64 
4.2.4.2. Analiza widma EI-MS oraz HR EI-MS 
65 
4.2.5. Analiza widm NMR 
68 
4.2.5.1. Analiza widm 1H NMR 
68 
4.2.5.2. Analiza widm 13C CP NMR 
73 
4.2.5.3. Analiza widma 13C DEPT NMR 
75 
4.2.5.4. Analiza widma 15N NMR 
77 
4.2.5.5. Analiza widm dwuwymiarowych NMR 
78 
4.2.5.5.1. Widmo 1H,1H COSY LR 
78 
4.2.5.5.2. Widmo 1H,13C HMBC NMR 
81 
4.2.5.5.3. Widmo 1H,15N HMBC NMR 
83 
4.2.5.5.4. Widmo 1H,13C HSQC NMR 
84 
4.2.5.5.5. Widmo 1H,1H NOESY NMR 
86
		

/p0009.djvu

			Spis treści 
____________________________ __ _ __ _ ___ _ __ _ __ _ __ __ _ __ _______________________ 
4.3. 
Optymalizacja preparatyki związku WP 
88 
4.3.1. Metoda spektrofotometryczna oznaczania stężenia substancji 
88 
4.3.1.1. Krzywa wzorcowa 
88 
4.3.1.1.1. Chlorek X 
88 
4.3.1.1.2. Związek WP 
90 
4.3.2. Wyniki pomiarów kinetycznych dla poszczególnych temperatur 
92 
4.3.2.1. Temperatura 313 K 
92 
4.3.2.1.1. Pomiary dla ubytku substratu 
92 
4.3.2.1.2. Pomiary dla przyrostu stężenia produktu 
95 
4.3.2.2. Temperatura 323 K 
98 
4.3.2.2.1. Pomiary dla ubytku substratu 
98 
4.3.2.2.2. Pomiary dla przyrostu produktu 
101 
4.3.2.3. Temperatura 333 K 
104 
4.3.2.3.1. Pomiary dla ubytku substratu 
104 
4.3.2.3.2. Pomiary dla przyrostu produktu 
107 
4.3.2.4. Temperatura 343 K 
110 
4.3.2.4.1. Pomiary dla ubytku substratu 
110 
4.3.2.4.2. Pomiary dla przyrostu produktu 
113 
4.3.3. Zastosowanie równania Arrheniusa 
116 
4.4. 
Wyznaczanie wartości przemiany 50% chlorku związku X w sól 
wewnętrzną 2-(2-karboksy-4,5-dimetoksyfenylo)-6,7- 
dimetoksyizochinoliniową (pH50%) 
120 
4.5. 
Oznaczenie rozpuszczalności 
122 
4.5.1. Oznaczenie rozpuszczalności soli 2,3,9,10-tetrametoksy-12-okso-12H- 
indolo[2,1-a]-izochinioliniowych 
122 
4.5.1.1. Krzywa wzorcowa 
122 
4.5.1.2. Oznaczanie rozpuszczalności soli związku X 
124 
4.5.2. Oznaczenie rozpuszczalności związku WP 
125 
4.5.2.1. Krzywa wzorcowa 
125 
4.5.2.2. Wyniki oznaczenia rozpuszczalności 
127 
4.5.3. Oznaczenie rozpuszczalności związku NF 
127 
4.5.3.1. Krzywa wzorcowa 
127 
4.5.3.2. Wyniki oznaczenia rozpuszczalności 
129 
4.6. 
Wyznaczanie współczynnika lipofilowości dla związku X, WP oraz NF 
metodą chromatografii cienkowarstwowej 
130 
4.7. 
Wyznaczenie cytotoksyczności -- test IC50 
135 
4.7.1. Chlorek NF 
135 
4.7.2. Jodek X 
136 
4.7.3. Związek WP 
137 
4.8. 
Oznaczanie hamowania aktywności telomerazy i polimerazy 
139 
4.9. 
Oznaczenie powinowactwa do DNA 
141 
5. 
OMÓWIENIE I DYSKUSJA WYNIKÓW 
143 
6. 
WNIOSKI 
157 
7. 
STRESZCZENIE 
158 
8. 
SUMMARY 
159 
9. 
PIŚMIENNICTWO 
160
		

/p0010.djvu

			1. Wstęp 
__________________________________________________________________________ 
4 
1. Wstęp i cel pracy 
Głównym przedstawicielem alkaloidów izochinolinowych stosowanych w 
lecznictwie jest papaweryna. Należy ona do leków spazmolitycznych o działaniu 
muskulotropowym. Ze względu na słabą rozpuszczalność zasady w lecznictwie 
stosuje się jej sole: chlorowodorek i siarczan. Ze względu na obecność mostka 
metylenowego, w obrębie którego zachodzi proces utleniania, ulega ona 
utlenieniu kolejno do papawerynolu i do papaweraldyny [1]. Wynika to z 
przestrzennego rozmieszczenia atomów w cząsteczce papaweryny a konkretnie z 
braku zawady przestrzennej, która uchroniłaby ten element struktury przed 
ewentualnymi czynnikami utleniającymi. Podatność papaweryny na przemiany 
oksydacyjne była przyczyną podjęcia badań mających na celu ustalenie wpływu 
różnych czynników na przebieg tego procesu oraz zidentyfikowanie powstających 
produktów [2, 3]. 
W żółto zabarwionych roztworach iniekcyjnych siarczanu papaweryny 
wykazano obecność papawerynolu, papaweraldyny oraz nieznanej substancji 
oznaczonej jako X [2]. Badania prowadzone w latach 60. XX wieku potwierdziły 
obecność powyższych związków w preparatach leczniczych chlorowodorku 
papaweryny a ponadto na chromatogramie odkryto pasma dodatkowych 
produktów rozkładu [3]. Struktura nieznanej substancji X została rozwiązana na 
początku XX wieku - jest to chlorek 2,3,9,10-tetrametoksy-12-okso-12H- 
indolo[2,1-a]izochinoliniowy [4, 5]. Związek X po dodaniu roztworu NaOH 
odbarwia się [4] i powstaje nowa nieznana pochodna. 
Celem naukowym rozprawy jest preparatyka i rozwiązanie struktury nowej 
nieznanej pochodnej powstałej w wyniku alkalizacji roztworu związku X. Projekt 
badawczy ponadto koncentruje się na wyznaczeniu rozpuszczalności oraz 
współczynnika lipofilowości nowych pochodnych papaweryny. Badania 
spektroskopowe nowej, nieznanej pochodnej pozwolą rozwiązać jej strukturę a 
przeprowadzenie badań in vitro umożliwi określenie jej ewentualnego działania 
przeciwnowotworowego oraz powinowactwa do DNA w porównaniu do związku X 
z którego powstaje [6].
		

/p0011.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
5 
2. Część teoretyczna 
2.1. Właściwości fizykochemiczne papaweryny 
Papaweryna jest alkaloidem izochinolinowym, który występuje w maku 
lekarskim (Papaver somniferum). Po raz pierwszy została wyizolowana z opium 
przez Mercka w 1848 roku. Merck dokonał również ustalenia wzoru sumarycznego, 
natomiast struktura alkaloidu została ustalona przez Goldschmiedta i 
współpracowników. Początkowo ustalono, że w papawerynie znajduje się pierścień 
chinolinowy. Wskutek dalszych analiz wykazano, że jest ona pochodną 
izochinolinową. Po raz pierwszy pełnej syntezy dokonali Pictet i Gams w 1909 roku 
[7]. Papaweryna jako zasada praktycznie nie rozpuszcza się w wodzie. Rozpuszcza 
się w gorącym benzenie, lodowatym kwasie octowym, chloroformie. Słabo 
rozpuszcza się w czterochlorku węgla i eterze naftowym. W lecznictwie stosuje się jej 
rozpuszczalną sól: siarczan bądź chlorowodorek [8]. 
N 
H3CO 
H3CO 
OCH 3 
OCH 3 
HCl 
Rys. 1. Chlorowodorek papaweryny (chlorowodorek 1-(3,4-dimetoksybenzylo)-6,7- 
dimetoksyizochinoliny) [9] 
Papaweryna zasada: 
Wzór sumaryczny: C20H21NO4 
Masa molowa: 339,40 g/mol 
Postać: biały krystaliczny proszek
		

/p0012.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
6 
Temperatura topnienia: 147-148˚C 
Papaweryna zasada nie rozpuszcza się w wodzie, rozpuszcza się w chloroformie, 
kwasie octowym lodowatym, gorącym etanolu i benzenie. 
Chlorowodorek papaweryny: 
Wzór sumaryczny: C20H21NO4 · HCl 
Masa molowa: 375,85 g/mol 
Postać: biały, krystaliczny proszek 
Temperatura topnienia: 220-225 ˚C (z rozkładem) 
Chlorowodorek papaweryny rozpuszcza się we wrzącej wodzie, chloroformie i 
etanolu. Praktycznie nie rozpuszcza się w eterze etylowym. 
Wodne roztwory chlorowodorku papaweryny o stężeniu 2% wykazują pH kwaśne 
około 3,3, natomiast roztwory o stężeniu 0,05 M charakteryzują się pH 3,9 [9]. 
2.2. Zastosowanie papaweryny w lecznictwie 
Obecnie papaweryna nie jest tak powszechnie stosowana w lecznictwie jak 
kiedyś, niemniej ze względu na właściwości spazmolityczne jest standardem w 
zakresie tego działania farmakologicznego. Wykorzystując jej budowę 
zsyntetyzowano grupę nowych leków spazmolitycznych. Jednym z nich jest 
drotaweryna, która występuje pod nazwą handlową NO-SPA (pochodna 
tetrahydroizochinoliny) i działa nieco silniej od papaweryny [10, 11, 12]. 
Papaweryna jest inhibitorem fosfodiesterazy (PDE). Jej działanie polega na 
rozkurczaniu mięśni gładkich narządów wewnętrznych poprzez blokowanie kanałów 
potasowych [13, 14, 15]. Hamowanie PDE prowadzi do wzrostu stężenia 
wewnątrzkomórkowych cAMP oraz cGMP. Sam enzym został odkryty w 1886 roku 
przez Henry Hyde Slatera. Odkrywca był astmatykiem i stwierdził, że po wypiciu 
kawy na pusty żołądek jego oddech się uspakajał. Był to łagodny efekt 
bronchodilatacyjny kofeiny - słabego inhibitora fosfodiesterazy. Fosfodiestaraza 
występuje w 11 formach izoenzymatycznych [16]. Papaweryna jest inhibitorem PDE1 
(stymulowanej przez kalmodulinę), PDE2 (stymulowanej przez cGMP) oraz PDE4 
(stymulowanej przez cAMP) oraz PDE10A (stymulowanej przez cAMP) [17]. 
Izoenzym PDE1 znajduje się w mięśniach gładkich, PDE2 w sercu oraz płucach, 
PDE4 w wątrobie oraz płucach a PDE10A w mózgu. Ze względu na umiejscowienie
		

/p0013.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
7 
PDE10A w ośrodkowym układzie nerwowym (striatum) papaweryna polepsza funkcje 
poznawcze u szczurów, u których indukowano fencyklidyną schizofrenię [18]. Jej 
zastosowanie jednak ograniczone jest przez selektywność działania, a także przez 
parametry farmakokinetyczne [19]. Biologiczny okres półtrwania (t0,5) wynosi 0,25-1,3 
h [17, 20]. 
Chlorowodorek papaweryny jest stosowany w dawce 30-120 mg. Gwarantuje 
to szybkie przerwanie bólu. Badania in vitro dowiodły, że siła działania 
rozkurczającego jest zależna od dawki. Chlorowodorek papaweryny stosuje się 
szerzej w Izraelu w połączeniu z niesteroidowym lekiem przeciwzapalnym (NLPZ) np. 
diklofenakiem sodu. Na podstawie przeprowadzonych badań stwierdzono, że 
diklofenak sodu uwalnia od bólu w podobnym stopniu jak chlorowodorek 
papaweryny. Dzięki temu można ją stosować u ludzi, u których stwierdzono 
przeciwwskazania do stosowania NLPZ [17]. 
Ze względu na mechanizm działania chlorowodorek papaweryny stosuje się w 
chirurgii celem zniesienia skurczu naczyń. W celu rozszerzenia naczyń stosuje się 
dawkę 300 mg rozpuszczoną w 100 ml wody. Skurczone miejsce ostrzykuje się 
roztworem leku. W przypadku wystąpienia skurczów w wielu miejscach należy 
zachować ostrożność, bowiem w przypadku nastrzykiwania w wielu miejscach może 
dojść do hipotensji. To z kolei może doprowadzić do wzrostu ciśnienia 
wewnątrzczaszkowego, które można znieść roztworem mannitolu. Działanie 
utrzymuje się przez 30 do 60 minut [20, 21, 22]. W przypadku podania wlewu 
dożylnego działanie trwa 12-24 godzin. Potem należy wlew powtórzyć [23]. Aby 
zapewnić dłuższy efekt wazodilatacyjny prowadzono prace nad wszczepieniem 
peletek papaweryny w rozgałęzienia tętnic. Peletki uwalniają lek stopniowo. 
Przeprowadzone badania pokazały, że podanie dokanałowe jest w stanie zapobiec 
występowaniu skurczów przez dwa tygodnie. Niemniej ta metoda wymaga jeszcze 
dalszych prób zanim zostanie wprowadzona do lecznictwa [24]. Poza iniekcjami i 
peletkami można zastosować również kompresy nasączone roztworem 
chlorowodorku papaweryny. Wyizolowane naczynie wówczas rozkurcza się. 
Działanie to spowodowane jest dyfuzją leku z kompresu to komórek mięśni gładkich 
tętnicy [25]. 
Papaweryna podana dokanałowo stosowana jest również w leczeniu krwotoku 
podpajęczynówkowego, będącego jednym z głównych powodów chorobowości, 
śmiertelności po pęknięciu tętniaka mózgu. Niedokrwienie powoduje uszkodzenie
		

/p0014.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
8 
pewnych obszarów mózgu [26, 27, 28]. Podana dotętniczo wraz z innymi czynnikami 
wazodilatacyjnymi takimi jak nitroprusydek sodu czy też adenozyna rozszerza 
naczynia, przy czym zastosowana musi być w ciągu dwóch dni od wystąpienia 
krwotoku [21, 29, 30]. Taki sposób leczenia jest bardzo użyteczny w znoszeniu 
skurczów naczyń, których nie można rozszerzyć balonikiem (np. przednia tętnica 
mózgu, odgałęzienie środkowej tętnicy mózgowej) [31, 32]. 
Chlorowodorek papaweryny wydłuża czas drożności cewników w tętnicach 
obwodowych założonych u noworodków, u których konieczne jest częste pobieranie 
próbek krwi. Cewniki w tętnicach obwodowych zakładane są wówczas, gdy nie 
można założyć cewnika do tętnicy pępowinowej. Tętnice obwodowe mają skłonność 
do skurczów, co skutkuje skróceniem czasu użytkowania cewnika. Podanie 
papaweryny wydłuża ten czas [33]. Ponadto może być również stosowana w 
zwiększaniu przepływu krwi przez "by-pass" udowo-podkolanowy [34]. 
Chlorowodorek papaweryny stosowano również w leczeniu kłopotów ze 
wzwodem w postaci iniekcji do ciał jamistych. Efektem ubocznym było wystąpienie 
priapizmu i bólu [35, 36]. Obecnie ta metoda nie jest powszechnie stosowana ze 
względu na dostępność innych środków farmakologicznych [37, 38]. 
Papaweryna znalazła zastosowanie w leczeniu szumu w uszach. Podana 
doustnie lub dożylnie działa relaksacyjnie na mięśniówkę gładką polepszając w ten 
sposób krążenie krwi w ślimaku. Nie wykazano do tej pory działania ototoksycznego 
[39]. 
Podczas przeprowadzonych badań in vitro stwierdzono, że chlorowodorek 
papaweryny może powodować uszkodzenie komórek nabłonka. Badania 
przeprowadzono na liniach komórek tętnic świni i mięśni gładkich aorty szczura. Za 
mechanizm niszczący komórki odpowiedzialny jest najprawdopodobniej gromadzący 
się komórkowy cAMP, który doprowadza do aktywacji cAMP zależnej kinazy 
odpowiedzialnej za fragmentację DNA w komórce. Za kolejny mechanizm 
uszkadzający można uznać kwaśne pH iniekcji, które może prowadzić do koagulacji 
białek błony komórkowej [40, 41]. 
Perk G. i współpracownicy opisali przypadek pacjenta, który przyjął 200 
tabletek chlorowodorku papaweryny (á 40 mg). Doprowadziło to do wymiotów, 
biegunki, konwulsji, kwasicy mleczanowej, zasadowicy oddechowej oraz hipokaliemii. 
Działania te wynikają najprawdopodobniej z hamowania działania oksydazy 
mitochondrialnej [42].
		

/p0015.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
9 
W przypadku szybkiego podania dożylnego dużych dawek papaweryny można 
doprowadzić do niedowładu połowiczego, rozszerzenia źrenicy, ślepoty na jedno oko, 
wzrostu ciśnienia wewnątrzczaszkowego oraz depresji sercowo-oddechowej. 
Niektórzy badacze postulują, że ze względu na tworzenie mikrokryształów może 
dochodzić do zaczopowania naczyń [21, 43]. Roztworów chlorowodorku papaweryny 
nie należy łączyć z heparyną, ponieważ dochodzi do strącania osadu wolnej zasady 
[23]. 
Dawniej używano chlorowodorku papaweryny jako środka 
przeciwdrgawkowego, ponieważ zmniejszał on wychwyt adenozyny. Dragonow 
dowiódł, że adenozyna moduluje procesy zapalne w neuronach odpowiedzialne za 
pojawienie się ataków padaczki [21]. 
2.3. Trwałość roztworów papaweryny 
Ampułkowane roztwory chlorowodorku papaweryny są stosunkowo trwałe. 
Niemniej po trzech latach przechowywania stwierdzono pojawienie się żółtego, nawet 
brunatnego zabarwienia [2, 3]. Produktami rozkładu są m.in. papawerynol (II-rzędowy 
alkohol), papaweraldyna (keton). Powstałe produkty są wynikiem utlenienia grupy 
metylenowej w mostku łączącym pierścień izochinolinowy z pierścieniem fenylowym 
[5]. Wyżej wymienione produkty zanieczyszczają roztwory. Skutkuje to osłabionym 
działaniem farmakologicznym oraz wzrostem toksyczności w porównaniu z 
papaweryną [1]. 
Niedawno rozwiązano strukturę nowego produktu odkrytego w latach 50. XX 
wieku. Po raz pierwszy zidentyfikowano go jako widzialną w świetle dziennym 
brunatną plamę na chromatogramie. Oznaczono go jako "X" [2]. Przeprowadzono 
analizę widm UV-Vis oraz IR. Analiza widma wykonanego w podczerwieni wykazała 
obecność grupy karbonylowej. Analiza polarograficzna również potwierdziła 
obecność grupy karbonylowej, ponieważ nowy związek uległ redukcji. Ta technika 
analityczna umożliwiła również oznaczenie obok siebie papaweraldyny oraz związku 
"X" [44]. Później przeprowadzone badania za pomocą zaawansowanych technik 
NMR i MS pozwoliły ostatecznie rozwiązać strukturę nowej pochodnej [4]. 
Jest to 
chlorek 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1-a]- 
izochinioliniowy. Stwierdzono, że może on również powstawać z papawerynolu,
		

/p0016.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
10 
papaweraldyny oraz N-tlenku papaweryny. Reakcje te różnią się szybkością 
powstawania brunatnego produktu. Najszybciej powstaje on z papawerynolu, nieco 
wolniej z papaweraldyny oraz z papawerny zasady i N-tlenku papaweryny. Najwolniej 
powstaje z chlorowodorku papaweryny (Rys. 2) [4]. Po raz pierwszy ilościowo został 
on oznaczony metodą polarograficzną w roztworze obok papaweraldyny [44]. 
W roztworach chloroformowych chlorowodorku papaweryny proces 
fotorozkładu zachodzi jeszcze szybciej niż w roztworach wodnych. Obok 
papawerynolu oraz papaweraldyny stwierdzono obecność N-tlenku papaweryny. 
Pfeifer i wsp. wykryli go w roztworach niewodnych papawerny, które zostały 
poddane ekspozycji na światło dzienne. Został on wyizolowany metodą 
chromatografii preparatywnej. Ponadto stwierdzono również obecność N-tlenku 6,7- 
dimetoksyizochinoliny. Z kolei zachodząca w roztworach alkoholowych reakcja 
fotoalkilacji prowadzi do powstania 1-metylo oraz 1-etylodimetoksyizochinoliny [45, 
46, 47, 48].
		

/p0017.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
11 
N
H3CO
H3CO
OCH3
OCH3
N
H3CO
H3CO
OCH3
OCH3
N
H3CO
H3CO
OCH3
OCH3
N
H3CO
H3CO
OCH3
OCH3
× HCl
× HCl
OH
O 
O 
1
2
3
5
1-chlorowodorek papaweryny
2- chlorowodorek papawerynolu
3-chlorowodorek papaweraldyny
4- prawdopodobny produkt posredni
5-chlorek 2,3,9,10-tetrametoksy-12-okso-12-H-indolo[2,1-a]-izochinioliniowy.
+1/2O2
N
H3CO
H3CO
OCH3
OCH3
OH
4
+O2
Cl-
× HCl
Cl-
-H2O
+ 1/2 O2 -H2O
+1/2 O2
-H2O
Rys. 2. Schemat powstawania chlorku 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1-a]- 
izochinioliniowego
		

/p0018.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
12 
2.4. Spektroskopia NMR 
2.4.1. Rys historyczny 
Początki techniki NMR sięgają roku 1946, kiedy wykryto zjawisko 
magnetycznego rezonansu jądrowego. Cztery lata później zaobserwowano po raz 
pierwszy zjawisko przesunięcia chemicznego. W 1952 Purcell i Bloch otrzymują 
nagrodę Nobla za wyjaśnienie teoretycznych podstaw rezonansu magnetycznego. 
Pierwsze spektrometry, umożliwiające rejestrację widm 1H, pojawiły się w II połowie 
lat pięćdziesiątych XX wieku. W latach sześćdziesiątych nastąpił dalszy rozwój 
poprzez opracowanie spektrometru NMR umożliwiającego kumulację widm, a tym 
samym rejestrację słabych sygnałów. W roku 1971 pojawiła się idea rejestracji widm 
dwuwymiarowych. Została ona zrealizowana cztery lata później. Obecnie 
spektroskopia NMR jest bardzo użyteczna w rozwiązywaniu struktury nieznanych 
związków organicznych. Ponadto w ostatnich latach rozwinęła się technika 
konkurencyjna nazwana obrazowaniem magnetycznego rezonansu (MRI- magnetic 
resonance imaging). Umożliwia ona wizualizację organów wewnętrznych np. mózgu. 
Obraz tworzy woda (protony 1H) oraz kwasy tłuszczowe (grupy --CH2- łańcuchów 
alifatycznych). Jest on odzwierciedleniem gęstości protonów wody w tkankach danej 
części ciała [49, 50, 51]. 
2.4.2. Podstawy teoretyczne spektroskopii NMR 
2.4.2.1. Właściwości magnetyczne jąder 
Wszystkie jądra są obdarzone ładunkiem dodatnim. Jądro wiruje wokół osi, a 
zatem wytwarza pole magnetyczne i ma tzw. spinowy moment pędu (spin jądrowy) 
definiowany przez poniższy wzór: 
) 
1 
(+ 
=I 
I 
p 
ħ
		

/p0019.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
13 
gdzie: ħ to zredukowana stała Plancka (ħ=h/2π) a I -- jądrowa spinowa liczba 
kwantowa, która przyjmuje wartości: 0, 1/2, 1, 3/2, 2, itd. Wartość liczby spinowej 
zależy od liczby protonów i neutronów w jądrze atomu. Jeżeli I=0 wówczas oznacza 
to brak spinu. Są to jądra o parzystej liczbie protonów i neutronów i nie wykazują 
rezonansu. Przykładem takich jąder są 16O, 12C. Jeżeli jądra posiadają nieparzystą 
liczbę protonów i neutronów, wtedy liczba I jest liczbą całkowitą lub równą zeru (I= 0, 
1, 2, 3...). Przykładem takich jąder jest 14N oraz deuter. W przypadku, gdy ta suma 
jest nieparzysta wtedy I przyjmuje wartości połówkowe (I=1/2, 3/2, 5/2...). Takie jądra 
wykazują wtedy rezonans np. 1H, 13C, 15N. Jądra o spinie I=1/2 mogą być z łatwością 
rejestrowane, ponieważ charakteryzują się sferycznym rozkładem ładunku. Jądra 1H 
oraz 13C są najczęściej wykorzystywane w spektroskopii NMR. 
Moment magnetyczny jądra (μ) ilościowo wyraża magnetyzm jądra. Każde 
jądro, które ma spin jądrowy, ma także moment magnetyczny. Obie wielkości są 
proporcjonalne. Opisuje je pozniższa zależność: 
μ=γp 
gdzie: p jest spinem jądrowym a γ jest współczynnikiem magnetogirycznym 
(nazywanym również giromagnetycznym). Jest to stała charakterystyczna dla danego 
jądra [51, 52, 53]. 
2.4.2.2. Warunek rezonansu 
Wirujące jądra są podobne to magnesów, które oddziałują z zewnętrzym 
polem magnetycznym. Zgodnie z teorią kwantową w polu magnetycznym następuje 
przestrzenne kwantowanie spinu jądrowego p, który może przybrać 2I+1 różnych 
orientacji względem przyłożonego pola o natężeniu H0. Każda z tych orientacji ma 
określoną energię E: 
E=mIγħH0
		

/p0020.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
14 
Gdzie: mI to magnetyczna liczba kwantowa przyjmująca 2I+1 różnych wartości, H0 - 
natężenie pola magnetycznego. Pomiędzy sąsiadującymi orientacjami spinowymi 
istnieje różnica energii ΔE: 
ΔE=γħH0 
Proton o liczbie spinowej I=1/2 umieszczony w jednorodnym polu 
magnetycznym H0, może przyjąć orientację równoległą i antyrównoległą do linii tego 
pola. Jądra mogą przechodzić w położenia o wyższej energii i odwrotnie. Przejścia 
są możliwe jeżeli dostarczymy energię E=hν równą różnicy energii pomiędzy dwoma 
poziomami spinowymi. Wówczas nastąpi rezonans opisywany przez zależność 
nazywaną warunkiem jądrowego rezonansu magnetycznego: 
0 
2H 
π 
γ 
ν= 
Jest to fundamentalne równanie w spektroskopii NMR. Koreluje ono 
zastosowane pole o częstości radiowej ν z natężeniem pola magnetycznego H0. Przy 
zachowaniu tego stosunku jest spełniony warunek rezonansu i energia jest 
absorbowana przez proton, który osiąga wyższy stan energetyczny, co umożliwia 
rejestrację widma. 
Częstotliwość ν nazywana jest również częstotliwością Larmora (νL). 
Energia o częstotliwości radiowej może być dostarczana do badanego układu 
metodą fali ciągłej i może być stopniowo zmieniana, bądź też metodą impulsową 
poprzez wzbudzenie wszystkich częstości w wyniku naświetlania jednym impulsem 
[51, 52, 53]. 
2.4.2.3. Przesunięcie chemiczne 
Przesunięciem chemicznym nazywamy zjawisko występowania różnych 
częstości rezonansowych sygnałów znajdujących się w różnym otoczeniu 
chemicznym. Polega ono na tym, że w widmie NMR ukazują się określone sygnały
		

/p0021.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
15 
rezonansowe dla poszczególnych protonów bądź ich grup w różnej odległości od 
wzorca. Jest to różnica położenia pasm absorpcji określonego protonu i protonu 
odniesienia. Jako wzorzec stosuje się najczęściej tetrametylosilan-TMS. Jest to 
związek obojętny chemicznie, rozpuszcza się w większości rozpuszczalników 
organicznych. Jego sygnał znajdujemy w obszarze, gdzie nie obserwuje się innych 
sygnałów. W przypadku, gdy widma rejestrowane są w ciężkiej wodzie (D2O) jako 
wzorzec stosuje się sól sodową kwasu 3-(trimetylosilylo)-1-propanosulfonowego 
(DSS) (Rys. 3.). 
H3C Si 
S 
CH3 
CH3 
O 
O 
OH 
Rys. 3. Wzór strukturalny DSS 
Położenie sygnałów odczytuje się ze skali przesunięć chemicznych δ lub 
rzadziej τ. Pomiędzy δ a τ występuje zależność: 
τ =10--δ 
Skala τ stosowana była do roku 1974. Na tej skali sygnał TMS miał 
przesunięcie chemiczne 10 ppm. 
Przesunięcie chemiczne może być zapisane w jednostkach bezwymiarowych 
lub w ppm z arbitralnie przyjętym zerem dla TMS. Wartość przesunięcia 
chemicznego w dużym stopniu zależy od odległości od innych oddziałujących 
czynników. Im mniejsza odległość od oddziałującego czynnika, tym jego wpływ na 
przesunięcie chemiczne będzie większy [50, 51].
		

/p0022.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
16 
2.4.3. Widma NMR 
2.4.3.1. Spektroskopia protonowego rezonansu magnetycznego 1H NMR 
Spektroskopia 1H NMR jest bardzo użyteczną techniką analityczną ze względu 
na łatwość przygotowania próbki, niewielką ilość badanej substancji oraz krótki czas 
wykonania widma. Warunkiem otrzymania prawidłowego widma jest odpowiednia 
rozpuszczalność. Wadą metody jest wąski zakres pomiarowy, który wynosi od 0 do 
15 ppm. Jeżeli związek posiada w swojej strukturze równocenne atomy wodoru, 
wówczas dochodzi do nakładania się sygnałów. Przykładem jest grupa metylowa 
gdzie protony są równocenne magnetycznie. Ich rotacja uśrednia ich otoczenie i na 
widmie widoczny jest singlet. 
Widma NMR rejestrowane są głównie dla próbek znajdujących się w 
roztworze. W przypadku gdy substancja jest labilna po rozpuszczeniu, bądź nie 
rozpuszcza się wcale, wówczas możemy rejestrować widmo w stanie stałym. Jest to 
bardzo użyteczne, jeżeli chcemy analizować lek w tabletce. Warunkiem jest to, aby 
sygnały substancji pomocnicznych nie nakładały się z sygnałami analitu. 
Rozpuszczalnik powinien być tak dobrany, aby rozpuścił substancję badaną i 
aby stężenie otrzymanego roztworu umożliwiło rejestracje widma. Do rejestracji widm 
stosuje się rozpuszczalniki deuterowane. Są to najczęściej chloroform, 
dimetylosulfotlenek (DMSO) oraz metanol. W widmie NMR pojawiają się sygnały 
rozpuszczalników. Wynika to z niepełnego zdeuterowania. Te sygnały z reguły nie 
zakłócają rejestracji widma i mogą być również stosowane jako wzorzec [54]. Sygnał 
dla chloroformu pojawia się przy 7,26 ppm, dla DMSO przy 2,54 ppm oraz dla 
metanolu przy 3,34 ppm. 
Powierzchnia pod sygnałem rezonansowym jest proporcjonalna do liczby 
protonów w danej grupie funkcyjnej. Protonowy rezonans magnetyczny ma 
zastosowanie w analizie ilościowej, głównie do określania składu mieszanin bez ich 
rozdzielania. Powierzchnia pod sygnałem jest proporcjonalna do stężenia. 
Momenty magnetyczne jąder oddziałują nie tylko z zewnętrznym polem 
magnetycznym, lecz także między sobą. Oddziaływania te zachodzą między 
elektronami wiązań. Są to sprzężenia spinowo-spinowe, opisywane przez stałą 
sprzężenia J. Jej jednostką jest herc [Hz]. Jeżeli w sąsiedztwie nie ma protonu
		

/p0023.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
17 
charakteryzującego się momentem magnetycznym obserwujemy pojedynczy sygnał 
na widmie. W przypadku obecności innego protonu dochodzi do rozszczepienia 
sygnału. Liczba składowych w multiplecie wynosi P=2nI+1, gdzie n-to liczba jąder o 
równocennym spinie I. Stosunek natężenia składowych multipletu jest opisywany 
przez trójkąt Pascala. Przykładem jest widmo octanu etylu. Możemy zaobserwować 
trzy sygnały. Singlet (1,88 ppm) i triplet (1,09 ppm) można przyporządkować grupom 
metylowym, natomiast kwartet (3,96 ppm) pochodzi od grupy metylenowej. 
Identyfikację sąsiadujących protonów ułatwia widmo 1H, 1H COSY NMR. Jest 
to najczęściej spotykany przykład widma dwuwymiarowego NMR (2D NMR). Było 
ono pierwszą techniką dwuwymiarową NMR opracowaną w 1971 roku. Widma 2D 
NMR stanowią podstawę np. do badania białek w roztworach. Umożliwiają nie tylko 
określenie sekwencji aminokwasów, ale również strukturę przestrzenną. Widma 1H, 
1H COSY NMR obejmują oddziaływania położonych obok siebie protonów. Widma 
obejmujące oddziaływania sięgające nawet do 5 wiązań to widma 1H, 1H COSY LR. 
Przykład prostego widma dwuwymiarowego przedstawia rys. 4. 
Rys. 4. Wzór i widmo 1H, 1H COSY NMR β-butyrolaktonu [50] 
O 
Hx Hy 
HmCH3a 
O
		

/p0024.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
18 
Sygnały leżące na przekątnej (diagonalne) to wszystkie protony obecne w 
cząsteczce. Z kolei sygnały boczne (pozadiagonalne lub korelacyjne) odpowiadają 
protonom, które sprzęgają się ze sobą. 
Na podstawie rys. 4 można stwierdzić, że protony grupy metylowej --CH3a (oś 
ν2, δ=1,4 ppm) sprzęgają się z protonem --Hm (oś ν1, δ=4,5 ppm). Na rysunku jest to 
uwidocznione sygnałem korelacyjnym K1. Znajduje się on na skrzyżowaniu linii 
rzutujących prostopadłe do siebie osie ν1 i ν2. Po przeciwnej stronie, symetrycznie 
względem przekątnej, znajduje się sygnał obrazujący to samo oddziaływanie. Poza 
oddziaływaniem z grupą metylową, proton --Hm oddziałuje również z protonami --Hx 
oraz --Hy. Oddziaływania te opisane są na widmie symbolami odpowiednio K2 i K3. Są 
to protony grupy --CH2--. Pomiędzy tymi dwoma protonami również zarejestrowane 
jest oddziaływanie. Na widmie jest ono uwidocznione w postaci sygnału K4. 
Z kolei oddziaływania przestrzenne protonów dobrze opisują widma NOESY. 
Sygnały uwidocznione na widmie reprezentują oddziaływania przez przestrzeń 
pomiędzy wodorami znajdującymi się blisko siebie przestrzennie. Są one użyteczne 
w rozwiązywaniu problemów konformacyjnych i konfiguracyjnych. 
Widma dwuwymiarowe obejmują również oddziaływania protonów z węglem 
oraz azotem. Mogą być to oddziaływania dalekiego zasięgu (HMBC) oraz bliskiego 
zasięgu (HSQC) [50, 53, 55]. 
Przesunięcie chemiczne protonów pozwala przyporządkować związek do 
określonej grupy np. protony alifatyczne leżą w zakresie 0-2 ppm a aromatyczne 6-9 
ppm. 
Na przesunięcie chemiczne protonu oddziałuje szereg czynników jak 
obecność podstawnika, heteroatomu, wiązanie wodorowe czy też pole magnetyczne 
indukowane przez wiązania. 
Każdy wprowadzany podstawnik do cząsteczki zmienia gęstość elektronową. 
Stwierdzono, że podstawniki charakteryzujące się dodatnim efektem 
mezomerycznym i indukcyjnym mają właściwości elektronodonorowe i mają wpływ 
przesłaniający. Z kolei podstawniki o ujemnym efekcie mezomerycznym i 
indukcyjnym mają właściwości elektronoakceptorowe i mają wpływ odsłaniający. 
Atom azotu oraz tlenu zmniejszają ekranowanie atomu wodoru, powodując 
zwiększenie przesunięcia chemicznego [56, 57, 58, 59]. Podobny efekt wywołuje 
również wprowadzenie wiązań wielokrotnych [56]. Na zmianę przesunięcia 
chemicznego mają wpływ również oddziaływania przestrzenne tzn. takie ułożenie
		

/p0025.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
19 
cząsteczki, w którym grupy funkcyjne znajdują się blisko siebie, pomimo że odległość 
między nimi jeżeli chodzi o liczbę wiązań jest duża. 
Wiązanie wodorowe ma szczególne znaczenie w przypadku labilnych 
protonów. Jest to czynnik silnie wpływający na przesunięcie chemiczne. Wyróżniamy 
wiązania wewnątrzcząsteczkowe oraz międzycząsteczkowe. Dotyczą one 
heteroatomów takich jak azot, siarka czy też tlen. Wiązanie wodorowe powoduje 
odsłanianie protonu, co skutkuje zwiększeniem się wartości przesunięcia 
chemicznego. Przykładem jest, przedstawione na rys. 5, przesunięcie protonów grup 
hydroksylowych 2,5-dihydroksypropiofenonu. 
H3CH2C 
O 
O 
HO 
H 
Rys. 5. Struktura 2,5-dihydroksypropiofenonu [50] 
Proton grupy hydroksylowej przy węglu 2 ma przesunięcie chemiczne 12,02 
ppm, a dla hydroksylu przy węglu 5 przesunięcie chemiczne wynosi 5,8 ppm. W 
przypadku wiązania wodorowego wewnątrzcząsteczkowego, na przesunięcie 
chemiczne wpływ ma stężenie badanej próbki. Przykładem jest fenol, dla którego pik 
grupy hydroksylowej w rozcieńczonych roztworach występuje przy 4,25 ppm, a dla 
roztworów stężonych występuje przy 6,75 ppm. Wiązanie wodorowe występuje 
również w zasadach Schiffa. 
Zmiana temperatury nie ma wpływu na przesunięcie chemiczne. Może mieć 
wpływ jedynie w sytuacji, gdy proton jest związany z heteroatomem. Wówczas 
następuje zrywanie bądź tworzenie wiązań wodorowych. 
Protony związane z heteroatomami podlegają również procesom wymiany [50, 
51].
		

/p0026.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
20 
2.4.3.2. Spektroskopia rezonansu magnetycznego 13C NMR 
Rozwój spektroskopii 13C NMR nastąpił w drugiej połowie lat 
siedemdziesiątych XX wieku. Zawartość izotopu węgla 13C w przyrodzie jest 
stosunkowo niewielka (1,1%) w przeciwieństwie do izotopu wodoru 1H (99,9%). W 
związku z tym zaledwie jeden na sto atomów węgla może wykazywać rezonans. 
Rejestracja takiego widma jest dłuższa. 
Początkowo interpretacja widm 13C NMR była trudna ze względu na 
sprzęganie się z protonami. Sygnały miały charakter multipletów i przy dużej 
zawartości węgla w cząsteczce widmo było trudne do odczytania. Aby tego uniknąć 
zastosowano odsprzęganie sygnałów wodoru. Wiąże się to z utratą danych o liczbie 
atomów wodoru, z którymi powiązany jest węgiel. Tutaj z pomocą przychodzi widmo 
13C DEPT, które pozwala rozróżnić, które węgle są związane z protonami. W widmie 
13C rejestrowanym z odprzęganiem tracimy również informację ilościową, bowiem 
powierzchnia piku nie jest proporcjonalna do liczby węgli. 
Widma węglowe charakteryzują się również szerszą skalą rejestracji. Zakres 
przesunięć chemicznych obejmuje 250 ppm. Jeżeli uwzględnimy atomy węgla w 
karbokationach i karboanionach to sięga on 600 ppm. Dzięki szerokiej skali 
przesunięć chemicznych oraz likwidacji multipletowości stosunkowo rzadko 
obserwuje się nakładanie sygnałów węglowych. Ponadto łatwo zarejestrować 
również obecność zanieczyszczeń w próbce. 
W rejestracji widm 13C NMR jako wzorzec wewnętrzny stosuje się, podobnie 
jak w przypadku widm protonów, tetrametylosilan (TMS). Sygnał węgli dla grup 
metylowych występuje przy 0 ppm. Współczesne spektrometry nie wymagają 
dodawania TMS i jako wzorzec traktuje się sygnał 13C deuterowanego 
rozpuszczalnika, w którym przygotowana jest próbka. 
Wielkość przesunięcia chemicznego jest uzależniona od hybrydyzacji atomu 
węgla. Atomy o hybrydyzacji sp3 występują pomiędzy 20-100 ppm, sp2 pomiędzy 
120-220 ppm a sp pomiędzy 70-130 ppm. Silnie elektroujemne podstawniki 
powodują zmniejszenie ekranowania węgla, sygnał przesuwa się w kierunku 
wyższych wartości przesunięcia chemicznego. Jeżeli w cząsteczkach występuje 
zawada przestrzenna obserwuje się efekt przesłaniania i przesunięcie chemiczne 
maleje.
		

/p0027.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
21 
Obecność podstawników o charakterze elektronoakceptorowym (atomy azotu, 
tlenu) zmiejsza gęstość elektronową na atomie węgla i przesunięcie chemiczne 
rośnie o kilkanaście do kilkudziesięciu ppm. Przykładem jest grupa --CH3, dla której 
przesunięcie chemiczne wynosi ok. 20 ppm [60]. Wprowadzenie atomu tlenu i 
utworzenie grupy metoksylowej powoduje zwiększenie wartości przesunięcia 
chemicznego do około 55 ppm [56]. Z kolei wprowadzenie kolejnego atomu tlenu 
(grupa karboksylanowa) przesuwa pik w kierunku jeszcze większych wartości około 
170 ppm [59, 60, 61]. Najsilniej odsłaniany jest węgiel bezpośrednio związany z 
podstawnikiem (węgiel α). W przypadku kolejnego węgla (węgiel β) ten wpływ jest 
niewielki. Przykładem jest aldehyd octowy, którego przesunięcie chemiczne atomu 
węgla grupy karbonylowej wynosi 200 ppm. Natomiast węgiel w pozycji β ma 
przesunięcie chemiczne 31 ppm. W przypadku wprowadzania do cząsteczek jodu 
można zaobserwować efekt odwrotny, czyli wzrost ekranowania jądra węgla. Jest to 
tzw. efekt ciężkiego atomu. Spowodowany jest wkładem dużej liczby elektronów 
wnoszonych przez ciężki atom i wzrost stałej ekranowania związanego z nim atomu 
węgla [50, 53]. 
W związkach charakteryzujących się układem wiązań nienasyconych można 
zaobserwować delokalizację ładunku, co z kolei wpływa na ekranowanie jąder. 
Przykładem może być różnica w przesunięciach chemicznych dla węgla karbonylu w 
acetonie i octanie metylu (Rys. 6). 
Przesunięcie chemiczne węgla grupy karbonylowej wynosi 210 ppm. W 
wyniku efektu mezomerycznego następuje zmiana gęstości elektronowej i wzrost 
ekranowania grupy karbonylowej, co skutkuje zmniejszeniem przesunięcia 
chemicznego do 171 ppm dla octanu metylu [50]. 
Rozpuszczalnik użyty do przygotowania próbki ma również wpływ na 
przesunięcie chemiczne. Zmiana ta wynosi około kilku ppm. Stężenie przygotowanej 
próbki ma również wpływ na przesunięcie chemiczne. Niemniej dla stężeń rzędu 10- 
15 % uznaje się, że wartości przesunięć chemicznych są stałe [50].
		

/p0028.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
22 
H3C 
CH3 
O 
H3C 
CH3 
O 
H3C 
O 
O 
CH3 
H3C 
O 
O 
CH3 
H3C 
O 
O 
CH3 
1 
2 
1 
2 
3 
Rys. 6. Efekt mezomeryczny dla acetonu i octanu metylu [50] 
2.4.3.3. Spektroskopia rezonansu magnetycznego 15N NMR 
Obok węgla oraz wodoru kolejnym pierwiastkiem szeroko rozpowszechnionym 
w przyrodzie jest azot. W przypadku azotu mamy dwa magnetycznie czynne izotopy. 
Są to 14N oraz 15N. Zawartość pierwszego nich wynosi 99,63%, niestety wykazuje on 
spin równy 1. Powoduje to silny efekt kwadrupolowy. Jądro to ma również bardzo 
niską czułość detekcji. Na widmach uwidacznia się to bardzo szerokimi liniami 
rezonansowymi o szerokości dochodzącej do kilku kHz. W spektrometrii NMR jąder 
azotu wykorzystuje się azot 15N. Charakteryzuje się spinem 1/2 oraz zerowym 
elektrycznym momentem kwadrupolowym, jednak jego zawartość w przyrodzie jest 
niewielka -- 0,37%. Widma NMR azotu 15N przypominają wyglądem widma 13C NMR. 
Widmo azotu 14N oraz 15N zostało przedstawione na rys. 7. 
Zakres przesunięć chemicznych dla związków organicznych azotu wynosi 
nawet do 1400 ppm. Przesunięcia chemiczne dla 14N oraz 15N są praktycznie 
jednakowe np. dla triizopropyloaminy wynoszą one odpowiednio -327,5 ppm oraz - 
327,8 ppm [62]. Wzorcem wewnętrznym jest ciekły amoniak lub nitrometan. W 
amoniaku atom azotu jest silnie ekranowany przez parę elektronową. W przypadku 
nitrometanu azot w grupie nitrowej jest odekranowany dzięki obecności dwóch 
atomów tlenu. Sygnał dla nitrometanu leży przy 0 ppm i jest to środek zakresu 
przesunięć chemicznych spotykanych w różnych związkach azotowych. Pewne jądra
		

/p0029.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
23 
mogą mieć przesunięcie dodatnie (nitrozozwiązki, związki diazowe) bądź też ujemne 
(cyjanki, N-tlenki). 
Rys. 7. Porównanie widm 14N oraz 15N [51] 
Przyjmuje się, że dodatnie wartości przesunięć mają te jądra azotu, których 
sygnały pojawiają się w niższych polach niż sygnały nitrometanu. 
W związku z użyciem dwóch różnych wzorców (amoniak i nitrometan) do 
detekcji jąder azotu możemy przeliczyć przesunięcia chemiczne ze skali nitrometanu 
na skalę amoniaku. Wychodzimy z założenia, że sygnał amoniaku leży w wyższych 
wartościach natężenia pola magnetycznego, przy -380 ppm w stosunku do 
nitrometanu. Na przesunięcie chemiczne atomów azotu wypływ ma hybrydyzacja 
atomu azotu, stopień utlenienia, obecność i stopień zdelokalizowania wolnej pary 
elektronowej. 
Efekty steryczne wpływają również na przesunięcie chemiczne. Wymiana 
podstawników przy grupie aminowej na większe prowadzi do zmniejszenia 
przesunięcia chemicznego atomu azotu. Zastąpienie jednej z grup metylowych w 
trimetyloaminie na metylową powoduje zmniejszenie przesunięcia chemicznego 
atomu azotu o 12 ppm [62]. 
Analiza widm NMR azotu jest użyteczna w rozróżnianiu tautomerów w 
zasadach Schiffa. Stwierdzono, że jeżeli obserwowane są różnice w przesunięciu 
chemicznym rejestrowanym dla próbki w stanie stałym oraz ciekłym, wówczas 
zasada w formie roztworu występuje w postaci grupy --OH. W przypadku braku 
różnicy świadczy to, że obie formy --NH i --OH występują w równowadze [63, 64]. 
Dzięki dużemu zróżnicowaniu zakresów przesunięć chemicznych widma NMR 
azotu są użyteczne w rozróżnianiu izomerycznych struktur zawierających atomy
		

/p0030.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
24 
azotu. Przykładem mogą być izocyjaniany, dla których zakres przesunięć 
chemicznych mieści się w zakresie od -365 do -338 ppm. W przypadku cyjanianów 
zakres ten obejmuje -222 pm do -190 ppm [50]. 
Podstawniki elektronoakceptorowe powodują odsłanianie i zwiększają wartość 
przesunięcia chemicznego a podstawniki elektrodonorowe powodują wzrost 
przesłaniania i zmniejszają przesunięcie. Przyłączenie atomu tlenu do atomu azotu 
powoduje wzrost przesunięcia chemicznego [65]. Atom azotu związany z atomem 
węgla wiązaniem pojedynczym ma mniejsze przesunięcie chemiczne niż w 
przypadku podwójnego wiązania. Dla papaweryny azot ma przesunięcie 298 ppm a 
dla armepawiny wynosi ono 33,5 ppm (rys.8) [66]. 
N 
H3CO 
H3CO 
OCH3 
N 
H3CO 
H3CO 
OH 
OCH3 
CH3 
Papaweryna 
Armepawina 
Rys. 8. Wzory strukturalne papaweryny i armepawiny [66] 
2.5. Spektrometria mas (MS) 
Spektrometria mas, podobnie jak magnetyczny rezonans jądrowy jest bardzo 
użyteczną metodą rozwiązywania struktury związków organicznych. Jest to metoda 
komplementarna w stosunku do innych metod analitycznych, ponieważ dostarcza 
informacji o strukturze, których nie można uzyskać innymi metodami. MS dostarcza 
informacji odnośnie masy cząsteczkowej i wzoru sumarycznego związku. Dzięki 
obecności charakterystycznych jonów fragmentacyjnych oraz dróg fragmentacji 
możemy uzyskać informacje o strukturze.
		

/p0031.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
25 
2.5.1. Metody jonizacji w MS 
Próbka, aby mogła ulec detekcji, musi zostać wcześniej zjonizowana. 
Wyrózniamy następujące metody jonizacji [50, 67]: 
• jonizacja elektronami (EI - electron impact) - próbka jest jonizowana 
strumieniem elektronów o energii 70 eV 
• jonizacja chemiczna (CI - chemical ionisation) - wykorzystuje się tzw. jony 
pierwotne gazu (metan, izobutan, woda), które reagują między sobą i tworzą 
jony wtórne. Jony wtórne z kolei jonizują cząstki badanej substancji 
• metody jonizacji bezpośredniej (DEI - direct electron impact ionisation, DCI - 
direct chemical ionisation) są to zmodyfikowane metody EI oraz CI 
• desorpcja polem (FD - field desorption) - cienką warstwę badanego związku 
umieszcza się na powierzchni anody. Pod wpływem ogrzewania i gradientu 
potencjału, elektrony emitowane przez anodę jonizują próbkę 
• spektrometria masowa jonów wtórnych (SIMS - secondary ion mass 
spectrometry)- próbkę osadza się na powierzchni metalowej folii, którą 
umieszcza się w komorze jonizacyjnej. Powierzchnię folii bombarduje się 
kationami cezu. W widmie masowym obserwujemy silne pozorne jony 
pseudomolekularne [M+H]+, a także produkty kationizacji badanego związku 
[M+Ag]+ 
• bombardowanie szybkimi atomami (FAB - fast atom bombardment) - próbka 
jest rozpuszczana w płynnej matrycy (np. gliceryna) i jest bombardowana 
strumieniem atomów argonu lub ksenonu o energii 2-8 keV. W widmie 
obserwuje się silny pik jonu pseudomolekularnego [M+H]+, a także jony 
fragmentacyjne 
• desorpcja laserowa w matrycy (MALDI - matrix-assisted laser desorption 
ionisation) - próbka jest naświetlana w matrycy krótkim laserowym impulsem 
UV, co powoduje odparowanie matrycy i wytworzenie jonów molekularnych 
• jonizacja przez termo- i elektrorozpylanie (TSI- thermospray ionisation i ESI- 
electrospray ionisation). W przypadku metod TSI do spektrometru mas jest 
wprowadzany roztwór, który ulega rozpyleniu w komorze. Powstają jony 
[M+H]+, [M+2H]+. Nie ulegają rozpadowi. W metodzie ESI wprowadza się 
próbkę pomiędzy ogrzewaną kapilarę a cylindryczną ściankę komory, gdzie
		

/p0032.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
26 
przyłożony jest potencjał 3-5 kV. W tej metodzie obserwuje się często jony 
pseudomolekularne. 
2.5.2. Proces fragmentacji 
Podstawą MS jest zjawisko fragmentacji jonów pod wpływem strumienia 
elektronów (EI - electron impact). Pod jego wpływem następuje jonizacja cząstki i jej 
rozpad na jony fragmentacyjne. Są dwie teorie procesu fragmentacji: teoria trwałości 
produktów fragmentacji oraz teoria lokalizacji ładunku [51, 53]. 
Teoria trwałości produktów fragmentacji opiera się na założeniu, że energia 
stanu przejściowego jest niewiele większa od energii produktów fragmentacji. Z tego 
wynika, że im mniejsza energia wewnętrzna produktów fragmentacji, tym mniejsza 
jest energia aktywacji procesu fragmentacji. Uprzywilejowana powinna być 
fragmentacja prowadząca do produktów o większej trwałości, czyli mniejszej energii 
wewnętrznej. Względną trwałość produktów fragmentacji można oszacować na 
podstawie wpływów elektronowych na trwałość kationów, rodniko-kationów oraz 
rodników. W procesie fragmentacji uprzywilejowany jest rozpad wiązań słabych, o 
niewielkiej energii. Dużą energią charakteryzują się niektóre silne wiązania 
pojedyncze takie jak C--F, C--H czy też O--H. Rozpad tych wiązań jest mało 
prawdopodobny, ponieważ energia aktywacji takiego rozpadu byłaby duża. 
Teoria lokalizacji ładunku zakłada, że ładunek dodatni jonu jest zlokalizowany 
w pewnych szczególnych miejscach. Są to orbitale heteroatomów obsadzone w 
neutralnych cząsteczkach przez niewiążące pary elektronowe, a także wiązania π 
nie wchodzące w skład układów sprzężonych. Miejsce lokalizacji tego ładunku działa 
jako inicjator fragmentacji, która może odbywać się w sposób homolityczny oraz 
heterolityczny (Rys. 9). 
Sposób homolityczny polega na niezależnym przemieszczaniu się 
niesparowanych elektronów. Rozpad heterolityczny polega na przemieszczaniu się 
całych par elektronowych. Obie teorie fragmentacji uzupełniają się wzajemnie -- 
teoria lokalizacji ładunku wskazuje wiązania szczególnie podatne na rozerwanie, 
natomiast teoria trwałości produktów fragmentacji umozliwia określenie kierunków 
fragmentacji.
		

/p0033.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
27 
R CH2 NH2 
R CH2 NH2 
+ H2C NH2 
R 
+e 
-2e 
Rozpad homolityczny 
Rozpad heterolityczny 
+e 
-2e 
Br 
Br 
CH2+Br 
Rys. 9. Rozpad homolityczny i heterolityczny [50] 
2.5.3. Rodzaje jonów w MS 
2.5.3.1. Jon molekularny i pik podstawowy 
Jon molekularny to rodniko-kation (M+·) powstały podczas jonizacji próbki. 
Powstaje w wyniku utraty elektronu przez cząsteczkę badanego związku zgodnie z 
równaniem: 
M+e M+·+2e 
W rzeczywistości w komorze jonizacyjnej pod wpływem bombardowania 
obojętnych cząstek strumieniem elektronów, zachodzić może cały szereg 
oddziaływań pomiędzy elektronami i obojętnymi cząsteczkami chemicznymi. 
Powyższe równanie można uznać za uproszczenie procesu jonizacji. Przy 
zastosowaniu jonizacji chemicznej cząsteczka badanej substancji przyłącza kation 
wodorowy bądź traci anion wodorowy i otrzymujemy następujące jony [M+H]+ po 
przyłączeniu H+ oraz [M-H]+ po odłączeniu H- 
. Wszystkie opisane powyżej jony to 
jony molekularne, gdyż powstają bezpośrednio w procesie jonizacji oraz najwierniej 
odzwierciedlają struktury badanych substancji. Jony molekularne powstające w tzw. 
jonizacjach miękkich (ESI-MS) nazywamy jonami pseudomolekularnymi, ponieważ w 
przeciwieństwie do jonizacji EI zamiast usuniętego bądź przyłączonego elektronu 
posiadają przyłączony lub odłączony jon wodorowy. Przykładem są allokryptopina 
oraz tetrahydroberberyna [68]. Z kolei norchelerytryna daje jony molekularne [69].
		

/p0034.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
28 
Pik podstawowy jest to pik o największym natężeniu. Ma on przypisane 
natężenie 100%. Natężenia pozostałych pików, w tym także piku molekularnego 
wyraża się jako procentowy stosunek do natężenia piku podstawowego. Jon 
molekularny może, ale nie zawsze musi być pikiem podstawowym. 
2.5.3.2. Jony izotopowe 
Każdy jon molekularny posiada określoną masę. Jest ona sumą nominalnych 
mas najbardziej rozpowszechnionych izotopów (12C, 1H, 14N, 16O). Obok jonu 
molekularnego istnieją jony molekularne zawierające mniej rozpowszechnione 
izotopy, które powodują pojawienie się pików izotopowych M+1 oraz M+2. Udział w 
powstawaniu jonów izotopowych M+1 mają cięższe izotopy (13C, 2H, 15N, 17O). Na 
tworzenie jonu izotopowego M+2 ma wpływ jedynie 18O. Jon ten jest bardzo słaby. 
Jeżeli cząsteczka zawiera siarkę lub krzem, wówczas natężenie jonu M+2 rośnie [50, 
52, 53]. 
2.5.3.3. Jony parzysto- i nieparzystoelektronowe 
Jon molekularny (M+·) jest to nieparzystoelektronowy rodniko-kation. Kationy 
nieparzystoelektronowe są mniej stabilne niż jony parzystoelektronowe, które 
posiadają zamknięte powłoki elektronowe. Podczas fragmentacji może odłączyć się 
nieparzystoelektronowy rodnik (R1·) lub trwała cząstka parzystoelektronowa (m1). 
Tworzenie jonów nieparzystoelektronowych jest preferowane, ponieważ 
odszczepienie rodnika prowadzi do powstania stabilniejszego kationu 
parzystoelektronowego (M2+). W trakcie dalszej fragmentacji jon parzystoelektronowy 
może odszczepić cząsteczkę parzystoelektronową (m3), przekształcając się w inny 
jon parzystkoelektronowy (M5+), natomiast prawie nie spotyka się rozszczepienia 
jonu parzystoelektronowego na jon nieparzystoelektronowy i rodnik (M6+ + R3·) (rys. 
10). 
Jon molekularny może odszczepić również cząsteczkę parzystkoelektronową 
(m1), zwłaszcza bardzo stabilną (np. CO), co prowadzi do powstania nowego jonu 
nieparzystoelektronowego (M1+·). Jon ten zachowuje się dalej jak jon molekularny -- 
rozpada się najczęściej na rodnik i jon parzystoelektronowy (M4++R2·). Rozpad jonu 
nieparzystoelektronowego w wyniku prostego rozszczepienia jednego z wiązań daje
		

/p0035.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
29 
zawsze jon parzystoelektronowy. Większość pików w widmie masowym odpowiada 
jonom parzystoelektronowym. Powstanie jonu nieparzystoelektronowego z innego 
jonu nieparzystoelektronowego wymaga rozszczepienia co najmniej dwóch wiązań i 
wiąże się zazwyczaj z przegrupowaniem jonu macierzystego. Przegrupowania 
charakteryzują się tworzeniem nowych wiązań. Jony nieparzystoelektronowe 
powstają często w wyniku fragmentacji pierścienia związków cyklicznych, która 
wymaga zawsze rozszczepienia co najmniej dwóch wiązań. Taki sposób rozróżniania 
jonów ułatwia interpretację widm, ponieważ określone rodzaje jonów mogą 
powstawać tylko w określonych typach fragmentacji. 
M 
X 
M1+m1 
M2+ +R1 
M3+m2 
M4+ +R2 
M6 +R3 
M5++m3 
Rys. 10. Schemat powstawania jonów. M+· 
- jon nieparzystoelektronowy, M+- jon 
parzystoelektronowy, m-cząsteczka parzystoelektronowa, R· 
- rodnik [50] 
2.5.3.4. Jony metastabilne 
Fragmentacja jonów jest wtórnym zjawiskiem wynikającym z oddziaływania 
elektronów z cząsteczkami. Do źródła elektronów przyłożony jest wysoki potencjał o 
tym samym ładunku co wypychane jony. Energia tych jonów jest proporcjonalna do 
do tego potencjału. Na drodze do detektora panuje niskie ciśnienie i eliminuje to 
możliwość oddziaływania z innymi cząstkami. Oznacza to, że całą energię uzyskaną 
na wyjściu ze źródła jony donoszą do detektora. Jeżeli jon po zbombardowaniu 
elektronami uzyska wystarczający nadmiar energii, rozpada się samoistnie w źródle 
na fragmenty, czyli mamy do czynienia z rozpadem masowym, w wyniku którego 
mogą powstawać kolejne jony fragmentacyjne. Jeżeli rozkład zachodzi wg 
następującego równania:
		

/p0036.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
30 
[AB]+·→ A+· + B° 
to zgodnie z tą reakcją w widmie masowym związku AB zostaną zarejestrowane 
pasma jonu [AB]+· oraz A+· 
. Fragment B° nie będzie widoczny, ponieważ nie posiada 
ładunku. Zgodnie z zaproponowanym podziałem, ta część populacji jonu [AB]+·, 
która nie uległa rozpadowi w źródle jonów i dotarła z całą energią wyniesioną z niego 
do detektora, będzie traktowana jako jon stabilny. Z kolei ta część populacji jonów 
[AB]+·, która się rozpadła w źródle na jon A+·, będzie zaliczana do jonów 
niestabilnych. Z kolei jon A+· (o ile nie nastąpi jego dalsza fragmentacja) opuszczając 
źródło, będzie posiadał swoją energię wewnętrzną, którą w całości doniesie do 
detektora, czyli też będzie jonem stabilnym. Jon AB+· to jon macierzysty a jon A+· to 
jon potomny. 
Jeżeli jon AB+· ulegnie fragmentacji zgodnie z poniższym równaniem już po 
opuszczeniu komory jonizacyjnej, ale jeszcze przed dotarciem do detektora, 
wówczas wyniesiona ze źródła energia całkowita E będzie podzielona na jon A+· oraz 
obojętną cząsteczkę B°: 
Ejonu [AB] +· → Ejonu A+· + Eobojętnej cząsteczkiB° 
W ten sposób do detektora dotrą dwa rodzaje jonów A+· 
. Pierwszy z nich 
będzie posiadał całkowitą energię wyniesioną ze źródła jonów, natomiast drugi 
będzie posiadał energię pomniejszoną o tą część, którą przekazał w procesie 
fragmentacji, zachodzącym tuż za źródłem jonów, obojętnemu fragmentowi B°. Takie 
jony o pomniejszonej energii nazywamy jonami metastabilnymi (m*). Stosunek m/z 
odpowiada dokładnie wartości stabilnego jonu A+· 
. Oba jony będą się jednak różniły 
niesioną energią i w ten sposób będą rozróżniane przez analizator elektryczny, który 
analizuje jony pod względem niesionej przez nie energii [50, 67].
		

/p0037.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
31 
2.6. Oznaczanie cytotoksyczności 
Oznaczanie cytotoksyczności in vitro pozwala już na wczesnym etapie 
stwierdzić działanie biologiczne nowopoznanych pochodnych. Na podstawie tych 
badań możliwe jest stwierdzenie ewentualnych dróg modyfikacji związku poprzez 
wprowadzanie bądź też usuwanie grup funkcyjnych celem optymalizacji działania 
cytotoksycznego [69]. 
Badania cytotoksyczności mogą obejmować oznaczenie zahamowania 
wzrostu linii komórek nowotworowych. Do nich możemy zaliczyć komórki raka układu 
nerwowego (SF-268), raka piersi (MCF7), raka płuc (NCI-H460), czerniaka skóry 
(BM), raka krtani (Hep-2) czy też raka żołądka (EPG-85) [6, 70]. Na podstawie 
zahamowania wzrostu komórek obliczana jest wartość IC50, czyli stężenia w którym 
następuje zahamowanie wzrostu komórek w 50%. Im mniejsza jest wartość IC50, tym 
związek jest bardziej cytotoksyczny. Cytotoksyczność oznaczana jest testem redukcji 
MTT. Żywe komórki redukują, przy użyciu dehydrogenazy bursztynianowej, żółty 
MTT (bromek 3-[4,5-dimetylotiazolo-2-ylo]- 2,5-difenylotetrazoliowy) do fioletowych 
kryształów formazanu. Donorami protonów są NADH oraz NADPH znajdujące się w 
łańcuchu oddechowym w mitochondriach. Intensywność zabarwienia jest wprost 
proporcjonalna do liczby żywych komórek (rys. 11) [72, 73]. 
NN 
N 
N 
N 
S 
CH3 
CH3 
Br 
NADH 
NADPH 
NN 
N 
H 
N 
N 
S 
CH3 
CH3 
MTT 
Formazan 
Rys. 11. Redukcja MTT [72] 
Badanie cytotoksyczności związku odbywa się również na drodze określenia 
wiązania z DNA. Oznaczanie to może być prowadzone na drodze miareczkowania 
spektrofotometrycznego, bądź też za pomocą dializy. Oznaczenia polegają na 
określeniu zmian w przebiegu widma UV-Vis badanej substancji. Miarą
		

/p0038.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
32 
powinowactwa jest wystąpienie efektu bato- lub hipsochromowego w badanej 
próbce. Wiązanie z DNA oraz przebieg widma są uzależnione od czynników takich 
jak stężenie elektrolitów, etanolu [6, 70, 71, 73, 74, 75, 76, 77]. Powinowactwo do 
DNA może być określone również za pomocą zmiany temperatury topnienia (ΔTm). 
Wyznaczenie krzywej topnienia dla czystego DNA oraz dla DNA związanego z 
liganiem jest źródłem informacji na temat siły wiązania badanej substancji z DNA. 
Jeżeli ΔTm jest większe niż 10 oznacza to, że substancja ma dobre powinowactwo do 
DNA [70, 78]. Sposób oddziaływania z DNA może być określony za pomocą techniki 
dichoroizmu kołowego (CD - circular dichoroism). Jeżeli maksimum absorpcji wystąpi 
przy 310-315 nm wówczas zachodzi wiązanie w bruździe DNA, natomiast jeżeli 
maksimum pojawi się przy 350-365 nm wówczas zachodzi interkalacja [71]. Jeżeli 
maksima absorpcji występują przy ok. 290 nm wówczas wskazuje to na wiązanie z 
kwadrupleksami guaninowymi [76]. 
2.7. Pojęcie lipofilowości związku 
Poprzez lipofilowość (hydrofobowość) określa się powinowactwo cząsteczki 
leku bądź innego ksenobiotyku do fazy organicznej. Cząsteczki lipofilowe to takie, 
które wykazują większe powinowactwo do fazy organicznej niż do fazy wodnej. Miarą 
lipofilowości jest podział w układzie dwufazowym ciecz-ciecz lub ciecz-ciało stałe. W 
przypadku układu ciecz-ciecz (np. n-oktanol/woda) mówimy o współczynniku 
podziału, natomiast dla układu ciecz-ciało stałe mówimy o retencji. O lipofilowości 
decydują oddziaływania zachodzące pomiędzy cząsteczkami substancji 
rozpuszczonej a cząsteczkami rozpuszczalnika. Z kolei poprzez hydrofobowość 
rozumie się przyciągające oddziaływania pomiędzy grupami niepolarnymi. Jest to 
zdolność do agregacji substancji w środowisku wodnym. W przypadku badań 
chromatograficznych do oddziaływań z niepolarną fazą stacjonarną używane jest 
pojęcie hydrofobowości. Lipofilowość ogranicza się do transportu cząstek substancji 
w organizmie żywym. Obejmuje ona procesy podziałowe pomiędzy fazą niepolarną 
(organiczną) oraz polarną (wodną). Wielkością opisującą stan podziału substancji w 
stanie równowagi pomiędzy dwiema niemieszającymi się fazami jest współczynnik 
podziału P (lub K).
		

/p0039.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
33 
w 
org 
c 
c 
P= 
gdzie: corg- stężenie substancji w fazie organicznej, cw- stężenie substancji w fazie wodnej 
Lipofilowość odgrywa decydującą rolę jako deskryptor właściwości 
biologicznych. Substancja chemiczna po dostaniu się do organizmu podlega 
szeregowi przemian biofizycznych i biochemicznych. W działaniu leku można 
rozróżnić trzy fazy: farmaceutyczną (postać leku i jego uwalnianie), 
farmakokinetyczną (transport leku) oraz fazę farmakodynamiczną (oddziaływanie z 
receptorem). Każdy z tych etapów związany jest z lipofilowością substancji. 
Lipofilowość największy wpływ wywiera na toksyczność leku oraz na procesy 
farmakokinetyczne a w szczególności na proces dystrybucji. 
Organizmy żywe zbudowane są z komórek posiadających błony białkowo- 
lipidowe, które zapewniają odgrodzenie się od środowiska. W przypadku organizmów 
wyższych stwierdzono wykształcenie się specjalnych barier umożliwiających izolację 
niektórych organów. Są to bariery: krew-mózg czy też bariera krew-łożysko. Procesy 
transportu wszystkich substancji wewnątrz organizmu polegają w głównej mierze na 
przenikaniu przez błony. W przypadku większości leków transport bierny jest 
czynnikiem warunkującym przenikanie cząstek przez błony. Im substancja jest 
bardziej lipofilowa, tym łatwiej przenika przez błony. 
Pojęcie lipofilowości jest bardzo użyteczne w syntezie nowych leków. 
Christopher Lipinski sformułował tak zwaną "regułę 5" dotyczącą badania 
właściwości leków. Według tej zasady słaba absorpcja oraz słabe przenikanie 
występują wówczas gdy jest więcej niż 5 donorów wiązań wodorowych (wyrażone 
przez sumę grup OH oraz NH), masa molowa jest większa niż 500, wartość logP jest 
powyżej 5, jest więcej niż 10 akceptorów dla wiązań wodorowych (wyrażone sumą 
atomów azotu i tlenu). Związki będące substratami dla biologicznych nośników są 
wyjątkami od tej reguły. Ta reguła jest użyteczna w syntezie nowych leków, niemniej 
ma ona kilka wyjątków. Do "reguły 5" nie pasują antybiotyki, witaminy, leki 
przeciwgrzybicze oraz glikozydy nasercowe, ponieważ cząsteczki z tych klas leków 
posiadają strukturę, która umożliwia transport przy pomocy nośników. 
Waterhouse opisała z kolei cechy, którymi powinny się charakteryzować leki, 
które przenikają przez barierę krew-mózg. Powinny się one charakteryzować logP 
niższym od 3,5. Ich masa molowa nie powinna przekraczać 450 g/mol i nie powinny
		

/p0040.djvu

			2. Część teoretyczna 
__________________________________________________________________________ 
34 
posiadać grup funkcyjnych, które silnie jonizują w fizjologicznym pH. Ponadto 
substancje te nie powinny mieć powinowactwa do glikoproteiny P ani wiązać się z 
albuminami osocza. Leopoldo i współpracownicy z kolei określili, że pochodne N-[4- 
(4-arylpiperazyn-1-ylo)butylo]arylokarboksamidów używane w pozytronowej 
tomografii emisyjnej (PET) do obrazowania receptorów D3 w mózgu powinny się 
charakteryzować logP w zakresie 2,5-3. Ustalenie lipofilowości już w warunkach in 
vitro pozwala wstępnie określić czy dana substancja będzie wchłaniała się z 
przewodu pokarmowego oraz czy będzie przenikała do ośrodkowego układu 
nerwowego. W tym ostatnim przypadku wysoka przenikalność pozwala uniknąć 
niepożądanych obwodowych działań ubocznych [79, 80, 81, 82, 83, 84, 85, 86, 87, 
88, 89].
		

/p0041.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
35 
3. Część doświadczalna 
3.1. Materiały i metody 
3.1.1. Odczynniki 
Podczas realizacji badań wykorzystano następujące odczynniki: 
• acetonitryl cz.d.a. (POCH, Gliwice), 
• chloroform cz.d.a. (POCH, Gliwice), 
• chlorowodorek papaweryny (Polfa Pabianice, Polska), 
• heksafluorofosforan amonu 99,9% (Sigma Aldrich, Niemcy) 
• jodek metylu (Fluka, Buchs, Szwajcaria), 
• kwas octowy 99,5% cz.d.a. (POCH, Gliwice), 
• kwas solny stężony (POCH, Gliwice), 
• metanol cz.d.a. (POCH, Gliwice), 
• octan rtęci(II) cz.d.a. (POCH, Gliwice; Sigma-Aldrich, Niemcy), 
• papawerynol otrzymany metodą Gadamera-Schulemanna (t.t. 136-137˚C), 
• płytki do chromatografii cienkowarstwowej POLYGRAM SIL G/UV254 
(Macherey-Nagel, Niemcy), 
• płytki do chromatografii cienkowarstwowej POLYGRAM AlOX G/UV254 
(Macherey-Nagel, Niemcy) 
• płytki do chromatografii cienkowarstwowej RP-18 F254s (Merck, Niemcy) 
• próbki DNA (Polgen, Łódź) 
• siarczan(VI) sodu bezw. cz.d.a. (POCH, Gliwice), 
• tioacetamid (AKT) cz.d.a. (POCH, Gliwice), 
• tlenek glinu Alumina B-Super I (ECO-CHROM, Niemcy), 
• węglan sodu cz.d.a. (POCH, Gliwice), 
• woda demineralizowana 
• wodorotlenek sodu cz.d.a. (POCH, Gliwice)
		

/p0042.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
36 
3.1.2. Aparatura 
Podczas realizacji badań korzystano z następujących urządzeń i aparatury: 
• aparat Boëtiusa (VEB Wägentechnik Rapido, Niemcy), 
• aparat do analizy elementarnej Vario EL III (Elementar, Niemcy), 
• komora pozioma do chromatografii cienkowarstwowej (Chromdes, Lublin) 
• komora Novodirekt do obserwacji płytek TLC wyposażona w lampy UV254 oraz 
UV365 o mocy 6W, 
• kolumna do klasycznej chromatografii cieczowej o średnicy 10 mm (Merck, 
Niemcy), 
• łaźnia wodna A100 (Lauda, Niemcy) 
• niskociśnieniowa lampa próżniowa TNN 15/32 Heraeus-Hanau (Niemcy), 
• spektrofotometr FT-IR Raman Magna 760 (Nicolet, Thermo-Nicolet, Madison, 
USA), 
• spektrometr mas Bruker Esquire~LC (Bruker, Ettlingen, Niemcy) 
• spektrometr mas Mass Spektrometer HP 5989 A (Agilent Technologies, 
Waldbronn, Niemcy), 
• spektrometr NMR Bruker AVANCE III (Broker, Ettlingen, Niemcy), 
• spektrofotometr UV-Vis, Specord M40 (Jena, Niemcy) z programem 
komputerowym do rejestracji i obróbki widma, 
• waga analityczna Sartorius BP110 S (Göttingen, Niemcy), 
• wirówka Hettich EBA 12 R typ 1002 (Hettich, Tuttingen, Niemcy) 
• wyparka próżniowa Rotavapor R-200 (BÜCHI, Szwajcaria), 
• zestaw do dializy Pierce Slide-A-Lyser MINI dialyser unit (Pierce, USA) 
3.1.3. Otrzymanie niektórych produktów utleniania papaweryny 
3.1.3.1. Otrzymanie papawerynolu oraz chlorku 13-(3,4-dimetoksyfenylo)- 
2,3,8,9-tetrametoksy-6a,12a-diazadibenzo[a,g]fluorenyliowego (związek 
NF) -- Metoda Gadamera-Schulemanna 
5,6 g chlorowodorku papaweryny rozpuszczono, ogrzewając na łaźni 
wodnej, w 25 ml wody z dodatkiem 5 ml kwasu octowego lodowatego. 
Jednocześnie przygotowano roztwór octanu rtęci(II) poprzez rozpuszczenie
		

/p0043.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
37 
10,2 g soli w 25 ml wody i 5 ml 2M kwasu octowego. Celem przyspieszenia 
rozpuszczenia octanu rtęci(II) mieszaninę ogrzano na łaźni wodnej. Po 
zmieszaniu obu roztworów mieszaninę ogrzano do temperatury 60˚C, następnie 
odstawiono na 24 h. Po upływie tego czasu ponownie ogrzano do 70˚C i 
ogrzewano przez 2 h. Podczas ogrzewania wytrąca się osad octanu rtęci(I). Po 
ostudzeniu osad odsączono i przemyto niewielką ilością wody. Przesącz 
zakwaszono 50 ml 2 M kwasu solnego i ogrzano do temperatury 80˚C i dodano 
2,4 g AKT. Po wytrąceniu jonów rtęci w postaci siarczku rtęci(II) mieszaninę 
przesączono na sączku Schotta (G-4). Osad na sączku przemyto niewielką 
ilością 2 M kwasu solnego. Przesącz zalkalizowano nasyconym roztworem 
węglanu sodu, następnie ekstrahowano chloroformem. Roztwór chloroformowy 
osuszono bezwodnym siarczanem sodu. Po osuszeniu chloroform odparowano 
a żywicowatą pozostałość rozpuszczono w najmniejszej ilości wrzącego etanolu 
pod chłodnicą zwrotną i po odsączeniu odstawiono do krystalizacji. 
Papawerynol po krystalizacji odsączono, przemyto etanolem i osuszono. 
Związek NF izolowano z mieszaniny metodą preparatywnej chromatografii 
cieczowej. W tym celu z przesączu po papawerynolu oddestylowano etanol i 
rozpuszczono w najmniejszej ilości chloroformu. Rozdział prowadzono na 
kolumnie wypełnionej Al2O3. Fazę ruchomą stanowił czysty chloroform, 
mieszaniny chloroform-metanol (19:1, 9:1, 1:1) a na końcu czysty metanol. 
Związek NF w postaci intensywnego, niebiesko-fioletowaego pasma eluowany 
jest czystym metanolem. Metanol oddestylowano. Suchą pozostałość 
rozpuszczono we wrzącym etanolu. Do zimnego roztworu dodano następnie 
kilka kropli 2 M HCl i kilka kropli toluenu aż do pojawienia się zmętnienia. 
Następnie strąciła się większa ilość osadu, którą przemyto zimnym metanolem 
Czystość substancji sprawdzono za pomocą TLC na płytkach powleczonych 
żelem krzemionkowym: Rf wynosi 0,51. Fazę ruchomą stanowiła mieszanina 
metanolu i chloroformu (1:9 v/v). 
3.1.3.2. Synteza chlorku 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1-a]- 
izochinoliniowego (związek X) oraz jodku i heksafluorofosforanu X 
50 ml chloroformowego roztworu papawerynolu o stężeniu 0,3 % (m/v) 
eksponowano na promieniowanie UV o długości fali λ= 254 nm. Czas
		

/p0044.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
38 
naświetlania wynosił 4,5 h za pomocą niskociśnieniowej lampy rtęciowej. Po 
upływie tego czasu chloroform odparowano a suchą pozostałość rozpuszczono 
na gorąco pod chłodnicą zwrotną w najmniejszej ilości metanolu i odstawiono 
do krystalizacji. Chlorek 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1-a]- 
izochinoliniowy wykrystalizował jako bezpostaciowy czarny osad o temperaturze 
topnienia 180-185 °C. Czystość sprawdzono za pomocą chromatografii 
cienkowarstwowej (TLC) przy użyciu płytki pokrytej żelem krzemionkowym. 
Fazę ruchomą stanowiła mieszanina metanolu i chloroformu (1:9 v/v). Rf 
substancji wynosi 0,14. Detekcję płytek przeprowadzono w świetle widzialnym, 
UV254 i UV366. 
Jodek X otrzymuje się poprzez rozpuszczenie suchej pozostałości w 4 ml 
gorącego metanolu i dodanie do niego 0,2 ml jodku metylu. Po krystalizacji osad 
odsączono i przemyto. 
Heksafluorofosforan X otrzymano poprzez rozpuszczenie chlorku X w 
wodzie i dodanie do niej roztworu NH4PF6. Wytrącony osad przemyto i 
osuszono. 
3.1.3.3. Preparatyka soli wewnętrznej 2-(2-karboksy-4,5-dimetoksyfenylo)- 
6,7-dimetoksyizochinoliniowej (związek WP) 
0,02 g chlorku 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1-a]- 
izochinioliniowego rozpuszczono w 3 ml 0,4% wodorotlenku sodu. Mieszaninę 
ogrzewano przez godzinę w temperaturze 70˚C a następnie wirowano i 
dekantowano. Oddzieloną ciecz odparowano na wyparce. Suchą pozostałość 
rozpuszczano w mieszaninie 400 μl metanolu i 1600 μl chloroformu. 
Rozdzielano na kolumnie chromatograficznej o średnicy 1 cm wypełnionej 8 
gramami Al2O3 do chromatografii o wielkości ziaren 5-200 μm. Eluowano 
mieszaniną chloroformu i metanolu. Elucję zaczynano od czystego chloroformu 
(cz.d.a.) celem oddzielenia zanieczyszczeń. Następnie eluowano mieszaniną 
chloroform-metanol o następujących składach (v/v) 20:1, 10:1, 5:1, 1:1. Na 
końcu eluowano czystym metanolem (cz.d.a.). Zbierano dwie frakcje. W 
pierwszej z nich znajdowały się produkty uboczne, natomiast w drugiej 
znajdowała się sól wewnętrzna 2-(2-karboksy-4,5-dimetoksyfenylo)-6,7-
		

/p0045.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
39 
dimetoksyizochinoliniowa. Detekcję produktu na kolumnie prowadzono przy 
użyciu lampy UV366. Badany związek wykazywał białą fluorescencję. 
Frakcję drugą odparowano do sucha na wyparce obrotowej. Badana 
substancja słabo rozpuszcza się w wodzie i w chloroformie. Podczas procesu 
oczyszczania obejmującego zmieszanie z mieszaniną chloroformu i wody oraz 
odwirowanie w temperaturze 4˚C substancja pojawia się na granicy dwóch faz 
rozpuszczalników w postaci białego proszku. Wydajność reakcji wynosi 10%. 
3.1.4. Badania strukturalne 
3.1.4.1. Analiza elementarna 
Oznaczenia ilościowe węgla, azotu i wodoru w badanych próbkach 
chlorku i heksafluorofosforanu 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1-a]- 
izochinioliniowego oraz soli wewnętrznej 2-(2-karboksy-4,5-dimetoksyfenylo)- 
6,7-dimetoksyizochinoliniowej wykonano na aparacie Vario EL III firmy 
Elementar. 
3.1.4.2. Widmo absorpcyjne UV-Vis 
Widma absorpcji związku WP (c = 7,5503 μM) oraz związku X (c = 
7,4120 μM) zarejestrowano w metanolu w kuwetach kwarcowych (d=10 mm) za 
pomocą spektrofotometru SPECORD M40. Roztworem odniesienia był metanol. 
Zakres rejestracji widma wynosił od 210 do 510 nm. 
3.1.4.3. Widmo IR 
Widmo w zakresie podczerwieni wykonano w tabletce zawierającej 1 mg 
substancji oraz 150 mg KBr. Zarejestrowano przebieg widma w zakresie od 
4000 do 40 cm-1.
		

/p0046.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
40 
3.1.4.4. Spektrometria mas (MS) 
3.1.4.4.1. Niskorozdzielcze widmo mas (EI-MS) 
Badania wykonano wykorzystując spektrometr mas Mass Spektrometer HP 
5989 A. Jako metodę jonizacji wykorzystano strumień elektronów o energii 70 
eV. Temperatura odparowania próbki wynosiła od 100˚C do 250˚C. 
Niskorozdzielcze widma mas wykreślono w zakresie od 40 do 600 m/z. 
3.1.4.4.2. Widmo mas (ESI-MS) 
Wysokorozdzielcze widma mas wykonano wykorzystując spektrometr 
mas Bruker Esquire-LC. Zastosowana technika jonizacji polegała na 
elekrorozpylaniu. Zakres rejestrowanych jonów wynosił od 50 do 1000 m/z. 
Wprowadzanie badanych próbek odbywało się wejściem poprzez chromatograf 
cieczowy HP1090 LC series II (detektor UV; kolumny Lichrosorb RP-select- 
5mm, faza ruchoma: metanol-0,1% roztwór kwasu mrówkowego 1:1; pH=6,5; 
szybkość przepływu 0,8 ml/min). 
3.1.4.4.3. Wysokorozdzielcze widmo mas (HREI-MS) 
Do rejestracji widma wykorzystano aparat MASPEC II SYSTEM. 
3.1.4.5. Jądrowy rezonans magnetyczny (NMR) 
Analiza NMR objęła zarówno widma jednowymiarowe 1H (300 MHz), 13C 
(75 MHz), 15N (30 MHz) jak i zaawansowane widma dwuwymiarowe 
rejestrowane za pomocą spektrometru NMR Bruker AVANCE III. Widma 
rejestrowano w dimetylosulfotlenku DMSO-d6 oraz metanolu-d4. Jako wzorzec 
wewnętrzny zastosowano TMS (tetrametylosilan). Dla widm 15N jako wzorzec 
wewnętrzny zastosowano deuterowany nitrometan. 
Widma NMR rejestrowane były za pomocą następujących technik: 
• 1HNMR 
• 15N NMR
		

/p0047.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
41 
• 13C CP NMR (Cross Polarization) 
• 13C DEPT NMR (Distortionless Enhancement by Polarization Transfer) 
• 1H, 1H COSYLR NMR (COSY for Long Range Couplings) 
• 1H, 1H NOESY NMR (Nuclear Overhauser Effect Spectroscopy) 
• 1H, 13C HMBC (Heteronuclear Multiple Bond Correlation) 
• 1H, 15N HMBC 
• 1H, 13C HSQC (Heteronuclear Single Quantum Correlation) 
Widma NMR oraz MS były rejestrowane w Pharmazeutisches Institüt der 
Christian-Albrechts-Universität w Kilonii, Niemcy. Widmo HR-EI MS było 
zarejestrowane w Instytucie Chemii Organicznej PAN w Warszawie. Widmo IR 
oraz analiza elementarna zostały wykonane w Środowiskowym Laboratorium 
Unikalnej Aparatury Chemicznej Wydziału Chemii UAM w Poznaniu. 
3.1.5. Optymalizacja otrzymywania nowej pochodnej (związek WP) 
Reakcję chemiczną powstawania nowego związku tj. soli wewnętrznej 2-(2- 
karboksy-4,5-dimetoksyfenylo)-6,7-dimetoksyizochinoliniowej (białego związku WP) 
przeprowadzono w następujących warunkach: 
• pobrano 1 cm3 0,2 M roztworu chlorku związku X i dodano do niego 1 cm3 0,2 M 
roztworu NaOH, KOH, LiOH, 
• badania prowadzono w temperaturach 313 K (40°C), 323 K (50°C), 333 K (60°C) i 
343 K (70°C), 
• próbki pobierano w podanych w poniższej tabeli odstępach czasowych: 
Tab. 1. Wartości temperatur, przedziałów czasowych i czasów trwania reakcji 
Temperatura 
[K] 
Przedziały 
czasowe 
pobierania próbek 
[min] 
Czasy 
trwania 
reakcji [min] 
313 
30 
180 
323 
15 
105 
333 
15 
105 
343 
5 
60
		

/p0048.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
42 
• z mieszaniny reakcyjnej pobierano próbkę (5 μl) i dodawano 1995 μl wody 
destylowanej, jako odnośnika użyto wodę z dodatkiem zasady o takim samym 
stężeniu jak w próbce badanej, 
• ubytek substratu i przyrost produktu oznaczano spektrofotometrycznie przy 
długości fali λmax = 310 nm (substrat) i λmax = 256 nm (produkt), 
• sporządzono krzywą wzorcową i określono parametry walidacji: precyzję, 
dokładność, liniowość, wykrywalność, oznaczalność, 
• z otrzymanych wyników wyznaczono stałą szybkości reakcji pierwszego rzędu, 
czas t0,1 i obliczono energię aktywacji w oparciu o równanie Arrheniusa. 
3.1.6. Wyznaczanie wartości pH połowicznej przemiany (pH50%) chlorku 
związku X w sól wewnętrzną 2-(2-karboksy-4,5-dimetoksyfenylo)-6,7- 
dimetoksyizochinoliniową 
Przygotowano serię roztworów NaOH o stężeniach 0,001 M, 0,0025 M, 0,005 
M, 0,0075 M, 0,01 M, 0,025 M, 0,05 M, 0,1 M oraz wodę. Każdy z nich uzupełniono 
odpowiednią ilością 4 M roztworu KCl tak, aby siła jonowa każdego z nich równa była 
μ=0,08. Do kuwety kwarcowej o grubości 10 mm odpipetowano 2000 μl 
poszczególnych roztworów, dodano 10 μl roztworu jodku X o stężeniu 2,5 mM. Jako 
odnośnik zastosowano 2000 μl odpowiedniego roztworu NaOH z dodatkiem 10 μl 
wody. Wykreślono widmo A=f(λ) w zakresie 225-510 nm. W obliczeniu pH50% 
korzystano z następującej zależności [91]: 
pH 
pH 
A 
A 
A 
A 
s 
s 
p 
p 
- 
= 
- 
- 
% 
50 
max 
max 
lg 
gdzie: 
Apmax- absorbancja próbki dodanej do 0,1M NaOH dla λ=256 nm 
Ap- absorbancja próbki badanej dla λ=256 nm 
Asmax- absorbancja próbki dodanej do wody dla λ=310 nm 
As -- absorbancja dla próbki badanej dla λ=310 nm
		

/p0049.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
43 
3.1.7. Badania rozpuszczalności w wodzie 
Do zbadania rozpuszczalności soli związków brunatnego X, białego WP 
oraz fioletowego NF wykorzystano metodę spektrofotometryczną. Badanie 
przeprowadzono w następujących warunkach: 
• temperatura pokojowa ( 25ºC ) oraz temperatura 37ºC. 
• detekcja w maksimum absorpcji związku "X" λ = 310 nm dla soli tego związku, 
dlaWPprzyλ=256nmorazdlaNFλ=280nm.Dlaoznaczeń 
rozpuszczalności kuwetę pomiarową spektrofotometru termostatowano. 
Każdą próbę przed oznaczeniem wirowano w termostatowanej wirówce z 
prędkością 15000 obr/min przez 15 minut a supernatant zbierano pipetą. Do 
wyznaczenia rozpuszczalności substancji przygotowano po dwie serie roztworów, 
każda składająca się z trzech próbek. Jako odnośnik w każdej próbie wykorzystana 
była woda podwójnie destylowana. 
Przy oznaczaniu rozpuszczalności heksafluorofosforanu X odważono ok. 0,002 g 
tej soli i dodano 2000 μl wody podwójnie destylowanej. Próbkę termostatowano 
przez 24 h w temperaturze 25°C oraz w 37°C. Po tym czasie pobrano 200 μl (dla 
temperatury 25°C) oraz 100 μl roztworu (dla temperatury 37°C), i uzupełniono wodą 
bidestylowaną do 2000 μl. Absorbancję mierzono przy λ = 310 nm. 
Badając rozpuszczalność chlorku X postępowano podobnie. Odważono ok. 0,006 
g soli, do której dodano 900 μl wody bidestylowanej. Roztwór pozostawiono na 24 h 
w temperaturze 25°C oraz w 37°C. Do zbadania absorbancji pobrano 3 μl roztworu 
(dla obu temperatur) i dodano do niego 2000 μl wody. Zmierzono absorbancję przy λ 
= 310 nm. 
Do oznaczenia rozpuszczalności jodku X odważono ok. 0,0045 g soli i dodano 
1000 μl wody bidestylowanej. Próbkę termostatowano przez 24 h w temperaturze 
25°C oraz w 37°C. Następnie pobrano 5 μl roztworu, który uzupełniono do 2300 μl 
wodą. Mierzono absorbancję przy λ = 310 nm. 
Przy badaniu rozpuszczalności WP odważono ok. 0,001 g substancji i dodano do 
niej 700 μl wody. Po 24 h inkubacji pobrano 20 μl powstałego roztworu i uzupełniono 
wodą do 2000 μl. Absorbancję próbki mierzono przy długości fali λ = 256 nm. 
Badając rozpuszczalność chlorku NF, odważono ok. 0,006 g soli, do której 
dodano 1000 μl wody podwójnie destylowanej. Roztwór pozostawiono na 24 h w
		

/p0050.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
44 
temperaturze 25°C. Do zbadania absorbancji pobrano 10 μl roztworu i dodano do 
niego 1990 μl wody. Zmierzono absorbancję przy λ = 280 nm. 
3.1.7.1. Wyznaczenie krzywych wzorcowych dla związków X, WP oraz NF 
Przy wyznaczaniu krzywej wzorcowej dla soli brunatnego związku "X" 
przygotowano roztwór podstawowy jodku związku "X" o stężeniu około 2,5 x 10-3 M w 
mieszaninie metanol:woda (1:1 v/v). Następnie otrzymano roztwory wzorcowe o 
stężeniach: 1,8530; 3,7060; 7,4120; 11,1180; 14,8240; 18,5230 x 10-6 M. Pomiar 
absorbancji przeprowadzono przy λ = 310 nm. 
Przy wyznaczaniu krzywej wzorcowej dla związku WP, przygotowano roztwór 
podstawowy związku WP o stężeniu około 8,1 x 10-4 M w metanolu. Na drodze 
miareczkowania spektrofotometrycznego otrzymano roztwory wzorcowe o 
stężeniach: 1,6228; 3,2391; 4,8490; 8,0496; 12,0149; 15,9414 x 10-6 M. Pomiar 
absorbancji przeprowadzono przy λ = 256 nm. 
Dla związku NF przygotowano roztwór podstawowy w metanolu o stężeniu około 
2,5 x 10-3 M. Następnie przygotowano roztwory o następujących stężeniach: 2,5641; 
5,1232; 10,2259; 15,3083; 20,3706; 25,4129; 30,4352 x 10-6 M. Pomiar absorbancji 
przeprowadzono przy λ = 280 nm. 
Krzywe wzorcowe zostały wykreślone jako zależność A=f(c). Parametry krzywych 
wzorcowych obliczono korzystając z metody najmniejszych kwadratów. Ponadto 
dokonano oceny statystycznej wyników. W celu oznaczenia precyzji i dokładności 
metody oznaczono różne stężenia związków w ciągu jednego dnia (intra-day-assay) 
oraz w ciągu kilku kolejnych dni (inter-day-assay). 
3.1.8. Badania lipofilowości 
Lipofilowość badanych związków wyznaczano przy użyciu chromatografii 
cienkowarstwowej. Analizę prowadzono na płytkach (10x10 cm) pokrytych żelem 
krzemionkowym RP-18 F254s. Chromatogramy rozwijano w poziomej komorze 
chromatograficznej. Płytki kondycjonowano przez 15 minut. Jako wzorców użyto 
substancji o znanej lipofilowości: izatyna (W1), 2,6-dichloroacetanilid (W2), 2,4- 
dichloroacetanilid (W3), 3,4-dichloroanilina (W4), 2,6-dichloroanilina (W5), p- 
nitrofenol (W6). Detekcję prowadzono przy użyciu lampy UV emitującej
		

/p0051.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
45 
promieniowanie o λ=254 nm. Fazę ruchomą stanowiły mieszaniny acetonitrylu i wody 
zawierające odpowiednio 45-80% acetonitrylu oraz 55-20% wody. Skok gradientu 
wynosił 5%. 
Obliczono Rf dla każdego związku a następnie Rm korzystając z 
następujących zależności: 
f 
f 
R 
R 
k- 
=1 
m 
R 
k= 
lg 
Następnie sporządzono wykres Rmw=f(logP) dla substancji wzorcowych i 
obliczono wartości log P dla substancji badanych. 
3.1.9. Badania aktywności biologicznej - test cytotoksyczności -- oznaczanie 
IC50 
Test redukcji MTT pozwala na szybkie oznaczenie cytotoksyczności badanego 
związku. Metoda polega na ocenie metabolizmu energetycznego komórki poprzez 
pomiar aktywności jednego z enzymów łańcucha oddechowego. Pod wpływem 
dehydrogenazy bursztynianowej, znajdującej się głównie w mitochondriach, żółta sól 
tetrazolowa - MTT (bromek 3-[4,5-dimetylotiazol-2-ylo]-2,5-difenylotetrazolowy) ulega 
redukcji do niebieskich, nierozpuszczalnych kryształów formazanu. Donorami 
protonów są NADH i NADPH. 
Powstałe w reakcji kryształy rozpuszczano przy pomocy roztworu 
solubilizującego (10% dodekasulfonian sodu (SDS) w 0,01 M HCl). Absorbancję 
mierzono przy pomocy spektrofotometru Labsystem Multiscan RC V1 przy 
długościach fal: 570 nm i 630 nm. Intensywność zabarwienia roztworu jest wprost 
proporcjonalna do ilości powstałego formazanu i jest miarą aktywności 
dehydrogenaz mitochondrialnych. Intensywność sygnału jest wprost proporcjonalna 
do ilości żywych komórek, ponieważ reakcja ta zachodzi jedynie w żywych 
komórkach.
		

/p0052.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
46 
3.1.10. Oznaczanie aktywności hamowania telomerazy oraz polimerazy 
Oznaczenie zostało wykonano przy użyciu testu ELISAPLUS. W tym celu do 
analizy użyto 2 μl lizatu (2000 komórek) z komórek MCF-7. Następnie dodano 
roztwór związków X oraz NF i otrzymano serię roztworów o stężeniach badanych 
substancji w zakresie 0,001-0,5 μM. W każdym z roztworów było takie samo stężenie 
primerów oligonukleotydowych oraz wzorca wewnętrznego polimerazy Taq (5 
jednostek/ μl). Związku WP nie badano w kierunku hamowania aktywności ponieważ 
nie wykazał on aktywności cytotoksycznej. 
Próbki inkubowano przez 20 minut w temperaturze 25°C. Następnie w celu 
amplifikacji produktów działania telomerazy wykonano reakcję PCR w następującej 
sekwencji: 94°C przez 5 minut, 50°C przez 30 sekund, 72°C przez 90 sekund i 72°C 
przez 10 minut. Po zakończeniu reakcji pobrano 100 μl mieszaniny i inkubowano 
przez 2 h w temperaturze 37°C, a następnie zmierzono absorbancję przy λ=450 nm. 
Wartość referencyjna aborbancji dla próby ślepej została zmierzona przy λ=690 nm. 
3.1.11. Badanie wiązania z DNA 
Określenie wiązania z DNA badanych substancji zostało przeprowadzone 
metodą dializy. W tym celu przygotowano w probówkach Eppendorfa próbki DNA w 
buforze kakodylowym o pH 6,85 (stężenie buforu 15 mM). Następnie inkubowano je 
w temperaturze 95°C przez 10 minut. Po schłodzeniu umieszczono je w lodówce na 
24 godziny. Następnie przygotowano roztwory podstawowe badanych substancji o 
stężeniu 100 μM. Z roztworów podstawowych przygotowano 250 ml dializatu o 
stężeniu substancji 1 μM w buforze kakodylowym. Gilzy do badania należy umyto 
wodą destylowaną i osuszono. 
Następnego dnia badane roztwory DNA wyjęto z lodówki i napełniono nimi 
uprzednio przygotowane gilzy. Objętość próbki wynosi 100 μl. Po napełnieniu 
rozpoczęto proces dializy, który trwał 24 godziny. 
Po upływie tego czasu badane roztwory przeniesiono do studzienek w 
mikropłytce UV-Vis (tzw. well-plate). Na płytkach, obok roztworów zawierających 
próbki DNA, znalazły się również roztwory mianowane do sporządzenia krzywej 
wzorcowej. Następnie zarejestrowano widma absorpcji poszczególnych próbek
		

/p0053.djvu

			3. Część doświadczalna 
__________________________________________________________________________ 
47 
badanych substancji w zakresie 230-550 nm. Po skończonym pomiarze przeniesiono 
roztwory na płytkę fluorescencyjną i następnie zarejestrowano widmo 
fluorescencyjne w zakresie 380-600 nm. Długość fali wzbudzenia wynosiła 310 nm. 
Po wykonaniu pomiarów dla każdego związku, korzystając z metody 
najmniejszych kwadratów, wyznaczono krzywą wzorcową. Stężenia poszczególnych 
związków obliczono na podstawie uzyskanych krzywych wzorcowych.
		

/p0054.djvu

			4. Wyniki 
__________________________________________________________________________ 
48 
4. Wyniki 
4.1. Analiza struktury chlorku 2,3,9,10-tetrametoksy-12- 
okso-12H-indolo[2,1-a]izochinioliniowego (związek X) 
4.1.1. Analiza widma UV-Vis 
Widmo związku X o stężeniu 13,65 μM zarejestrowano w metanolu i zostało 
ono przedstawione na rys. 12. 
Rys. 12. Widmo UV-Vis chlorku 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1-a] -- 
izochinioliniowego (λmax= 310 nm, lgε=4,74; λmax= 398 nm, lgε=4,10) 
0,00 
0,20 
0,40 
0,60 
0,80 
210 230 250 270 290 310 330 350 370 390 410 430 450 470 490 
Długość fali [ nm ] 
Absorbancja
		

/p0055.djvu

			4. Wyniki 
__________________________________________________________________________ 
49 
4.1.2. Analiza elementarna 
Przeprowadzono analizę elementarną dla chlorku oraz heksafluorofosforanu 
związku X. Oznaczono zawartość procentową węgla, azotu oraz wodoru. Wyniki 
zestawiono w tab. 2. 
Tab. 2. Wyniki analizy elementarnej dla chlorku oraz heksfluorofosoranu związku X 
4.1.3. Widmo ESI-MS 
W wyniku zastosowania metody jonizacji ESI-MS otrzymano jon molekularny 
dla związku X przy m/z = 352 (rys. 13). 
352.1 
+MS, 5.2min (#587) 
0 
1 
2 
3 
4 
5 
5 
x10 
Intens. 
100 
200 
300 
400 
500 
600 
700 
800 
900 
m/z 
Rys. 13. Widmo ESI-MS związku X 
Chlorek X 
Heksafluorofosforan X 
Oznaczany 
pierwiastek Zawartość 
teoretyczna 
[%] 
Zawartość 
doświadczalna 
[%] 
Zawartość 
teoretyczna 
[%] 
Zawartość 
doświadczalna 
[%] 
Węgiel 
61,94 
62,03 
48,30 
49,09 
Azot 
3,61 
3,61 
2,82 
2,82 
Wodór 
4,68 
4,81 
3,65 
3,88
		

/p0056.djvu

			4. Wyniki 
__________________________________________________________________________ 
50 
4.1.4. Widmo 1H NMR 
Widmo 1H NMR zostało zarejestrowane dla związku X w kwasie 
trifluorooctowym TFA (rys.14). 
Analiza widma została zamieszczona w tab. 3. 
Rys. 14. Widmo 1H NMR związku X 
Widmo wykazało obecność 6 protonów aromatycznych oraz 12 protonów 
pochodzących z czterech grup metoksylowych.
		

/p0057.djvu

			4. Wyniki 
__________________________________________________________________________ 
51 
Tab.3. Analiza widma 1H NMR związku X (s-singlet, d-dublet) 
Nr atomu 
wodoru 
δ [ppm] 
Rodzaj sygnału 
Liczba protonów 
1 
8,50 
s 
1 
4 
7,44 
s 
1 
5 
8,25 
s 
1 
6 
8,76 
d (J=6,2 Hz) 
1 
8 
7,58 
d (J=6,2 Hz) 
1 
11 
7,51 
s 
1 
2-OCH3 
4,166 
s 
3 
3-OCH3 
4,164 
s 
3 
9-OCH3 
4,11 
s 
3 
10-OCH3 
4,03 
s 
3
		

/p0058.djvu

			4. Wyniki 
__________________________________________________________________________ 
52 
4.1.4. Widmo 13C CP NMR 
Widmo 13C CP NMR dla związku X zostało zarejestrowane w TFA (rys. 15 i rys. 16). 
Rys. 15. Widmo 13C CP NMR związku X (zakres 58,5-61,5 ppm)
		

/p0059.djvu

			4. Wyniki 
__________________________________________________________________________ 
53 
Rys. 16. Widmo 13C CP NMR związku X (zakres 100-190 ppm)
		

/p0060.djvu

			4. Wyniki 
__________________________________________________________________________ 
54 
Analiza widma 13C CP NMR została przedstawiona w tab. 4. 
Tab. 4. Przesunięcia chemiczne poszczególnych atomów węgla w chlorku związku X 
Numer atomu węgla 
δ [ppm] 
Numer atomu węgla 
δ [ppm] 
1 
105,9 
10 
155,1 
2 
160,9 
11 
111,9 
3 
164,0 
11a 
119,4 
4 
109,7 
12 
186,7 
4a 
146,5 
12a 
136,5 
5 
129,7 
12b 
127,0 
6 
129,0 
2-OCH3 
60,06 
7a 
146,9 
3- OCH3 
60,26 
8 
101,9 
9- OCH3 
60,33 
9 
161,4 
10- OCH3 
59,81 
Analiza wykazała obecność 20 atomów węgla. 4 atomy węgla pochodzą od 
grup metoksylowych a 16 od układu pierścieniowego.
		

/p0061.djvu

			4. Wyniki 
__________________________________________________________________________ 
55 
4.1.4. Widmo 15N NMR 
Widmo 15N NMR dla związku X zostało zarejestrowane w TFA (rys. 17). 
Przesunięcie atomu azotu wynosi -177,22 ppm względem nitrometanu. 
Rys. 17. Widmo 15N NMR dla chlorku związku X
		

/p0062.djvu

			4. Wyniki 
__________________________________________________________________________ 
56 
4.1.5. Widmo 13C DEPT NMR 
Widmo 13C DEPT NMR zarejestrowano w TFA (rys.18). 
Rys. 18. Widmo 13DEPT NMR chlorku związku X 
Z atomami wodoru są związane następujące atomy węgla o następujących 
przesunieciach chemicznych [ppm]; 105,9; 109,7; 129,7; 129,0; 101,9; 111,9 oraz 
metoksyle: 60,06; 60,26; 60,33; 59,81.
		

/p0063.djvu

			4. Wyniki 
__________________________________________________________________________ 
57 
4.1.6. Widma dwuwymiarowe 
4.1.6.1. Widmo 1H,1H COSY LR NMR 
Rys. 19. Widmo 1H,1H COSY LR chlorku związku X zarejestrowane w TFA 
Tab. 5. Analiza widma 1H,1H COSY LR chlorku X (słabsze sygnały umieszczono w nawiasie) 
Proton Korelacja 1H,1H COSY LR Proton 
Korelacja 1H,1H COSY LR 
8,50 
4,166; (7,44); 8,25 
7,51 
4,11 
7,44 
(8,50); 4,164 
4,166 
8,50 
8,25 
8,50; 8,76 
4,164 
7,44 
8,76 
8,25 
4,11 
7,58 
7,58 
4,03 
4,03 
7,51
		

/p0064.djvu

			4. Wyniki 
__________________________________________________________________________ 
58 
4.1.6.2. Widmo 1H,13C HMBC NMR 
Rys. 20. Widmo 1H,13C HMBC NMR chlorku związku X 
Tab. 6. Analiza widma 1H,13C HMBC NMR (słabsze sygnały umieszczono w nawiasie) 
Proton 
Korelacja 1H,13C HMBC 
Proton 
Korelacja 1H,13C HMBC 
8,50 160,9; (109,7); 146,5; (186,7); 
136,5 
7,51 
146,9; (101,9); 161,4; (155,1); 
(119,4), 186,7 
7,44 (105,9); 160,9; 164,0; 129,7; 
(136,5); 127,0 
4,166 
105,9; 160,9 
8,25 
129,7; 129,0; (136,5); 127,0 
4,164 
164,0; 109,7 
8,76 
109,7; 129,7; 136,5 
4,11 
101,9; 161,4 
7,58 
146,9; 161,4; 155,1; (111,9); 
119,4; (186,7) 
4,03 
155,1; 111,9
		

/p0065.djvu

			4. Wyniki 
__________________________________________________________________________ 
59 
4.1.6.3. Widmo 1H,15N HMBC NMR 
Rejestrację widma przeprowadzono w TFA. 
Rys. 21. Widmo 1H,15N HMBC NMR chlorku związku X 
Zaobserwowano korelację atomu azotu z atomami wodoru o następujących 
przesunięciach chemicznych [ppm]: 8,25; 8,76; 7,58 oraz 7,51 (słaba).
		

/p0066.djvu

			4. Wyniki 
__________________________________________________________________________ 
60 
4.1.6.4. Widmo 1H,13C HSQC NMR 
Rys. 22. Widmo 1H,13C HSQC NMR chlorku związku X 
Analiza widma wykazała że bezpośrednio z atomami węgla są połączone 
następujące atomy wodoru: 1, 4, 5, 6, 8,11 oraz metoksyle 2, 3, 9, 10. 
Tab. 7. Korelacja 1H-13C HSQC NMR chlorku związku X 
Przesunięcie chemiczne 
protonu [ppm] 
Przesunięcie chemiczne atomu 
węgla [ppm] 
8,50 
105,9 
7,44 
109,7 
8,25 
129,7 
8,76 
129,0 
7,58 
101,9 
7,51 
111,9 
4,166 
60,06 
4,164 
60,26 
4,11 
60,33 
4,03 
59,81
		

/p0067.djvu

			4. Wyniki 
__________________________________________________________________________ 
61 
4.2. Rozwiązanie struktury nieznanej pochodnej (związek WP) 
4.2.1. Analiza widma UV-Vis 
Widmo UV-Vis zostało zarejestrowane w metanolu i zostało przedstawione na 
rys. 23. 
Rys. 23. Widmo UV-Vis związku WP o stężeniu 13,58 μM (kolor niebieski) oraz związku X o 
stężeniu 13,65 μM (kolor czarny) w metanolu 
Nowy związek wykazuje maksima absorpcji przy długości fali 256 nm oraz 
322 nm. Obliczono molowe współczynniki absorpcji (ε[mol·l-1·cm-1]) związku WP w 
metanolu, 0,1 M HCl oraz 0,1 M NaOH. Wyniki zestawiono w tab. 8. 
Tab. 8. Logarytmy molowych współczynników absorpcji (lgε) związku WP wyznaczone w 
metanolu, 0,1M HCl oraz 0,1M NaOH 
Logarytm molowego współczynnika absorpcji (lgε) 
Maksimum 
absorpcji [nm] 
Metanol 
0,1 M HCl 
0,1 M NaOH 
256 
4,77 
4,78 
4,76 
322 
4,17 
4,12 
4,11 
0,00 
0,20 
0,40 
0,60 
0,80 
1,00 
210 230 250 270 290 310 330 350 370 390 410 430 450 470 490 
Długość fali[nm ] 
Absorbancja
		

/p0068.djvu

			4. Wyniki 
__________________________________________________________________________ 
62 
4.2.2. Analiza widma IR 
Widmo IR zostało przedstawione na rys. 24 i w tab. 9. 
Tab. 9. Widmo w podczerwieni związku WP 
Liczba 
falowa [cm-1] 
Wiązanie 
Typ drgania 
3603 
wiązanie wodorowe woda 
rozciągające 
3397 
O -- H alifatyczne woda 
rozciągające 
3031 
CAr -- H aromatyczne 
rozciągające 
3020 
CAr -- H aromatyczne 
rozciągające 
2839 
C -- H alifatyczne 
rozciągające 
1773 
kombinacyjne pierścienia 
deformacyjne 
1632 
C = C aromatyczne 
rozciągające 
1608 
C = C aromatyczne 
rozciągające 
1599 
COO- gr. karboksylowa 
rozciągające 
1518 
C = C aromatyczne 
rozciągające 
1490 
C = N aromatyczne 
rozciągające 
1466 
C -- H alifatyczne 
deformacyjne (asym.) 
1455 
C -- H alifatyczne 
deformacyjne (asym.) 
1398 
COO- gr. karboksylowa 
rozciągające 
1353 
C -- N alifatyczne 
rozciągające 
1348 
C -- N alifatyczne 
rozciągające 
1282 
C -- H aromatyczne 
deformacyjne 
1267 
C -- H aromatyczne 
deformacyjne 
1222 
C -- C alifatyczne 
szkieletowe 
1199 
CAr -- O aromatyczne 
rozciągające 
897 
CAr -- H aromatyczne 
deformacyjne 
886 
CAr -- H aromatyczne 
deformacyjne
		

/p0069.djvu

			4. Wyniki 
__________________________________________________________________________ 
63 
Rys. 24. Widmo IR związku WP (Transmitancja (%) jako funkcja liczby falowej)
		

/p0070.djvu

			4. Wyniki 
__________________________________________________________________________ 
64 
4.2.3. Analiza elementarna 
Przeprowadzono analizę elementarną związku WP. Oznaczono zawartość 
procentową węgla, azotu oraz wodoru. Wyniki zestawiono w tab. 10. 
Tab. 10. Wyniki analizy elementarnej związku WP 
Związek WP 
Oznaczany pierwiastek 
Zawartość 
teoretyczna [%] 
Zawartość 
doświadczalna [%] 
Węgiel 
65,03 
63,28 
Azot 
3,79 
3,63 
Wodór 
5,18 
5,20 
4.2.4. Analiza widm MS 
4.2.4.1. Analiza widma ESI-MS 
W wyniku zastosowania jonizacji ESI-MS na widmie zaobserwowano jon 
pseudomolekularny [M+H] o m/z 370. Widmo przedstawiono na rys. 25. 
370.1 
+MS, 10.5mi n (#1044) 
0 
1 
2 
3 
4 
6 
x10 
Intens. 
100 
200 
300 
400 
500 
600 
700 
800 
900 
m/z 
Rys. 25. Widmo ESI-MS związku WP
		

/p0071.djvu

			4. Wyniki 
__________________________________________________________________________ 
65 
4.2.4.2. Analiza widma EI-MS oraz HR EI-MS 
Rys. 26. Widmo EI-MS związku WP
		

/p0072.djvu

			4. Wyniki 
__________________________________________________________________________ 
66 
Analiza widma przedstawiona została w tab. 11. Proces fragmentacji został 
przedstawiony na rys. 27. Analiza HR EI-MS wykazała, że jon molekularny [M+] ma 
wzór C20H19NO6 dla m/z 369,12205 (369,12124; Δ -2,2 ppm). 
Tab. 11. Analiza widma EI-MS związku WP 
Jon m/z 
Wzór sumaryczny 
Natężenie sygnału [%] 
a 369 
C20H19NO6 
100 
b 368 
C20H18NO6 
86 
c 352 
C20H18NO5 
71 
d 340 
C19H18NO5 
86 
e 324 
C19H18NO4 
81 
f 310 
C17H12NO5 
68 
g 294 
C17H12NO4 
53 
h 279 
C16H9NO4 
72 
i 264 
C15H6NO4 
20 
j 250 
C15H9NO3 
20 
k 236 
C14H6NO3 
17 
l 207 
C13H5NO2 
20 
m 188 
C11H10NO2 
14 
n 175 
C9H5NO3 
17 
o 164 
C9H8NO3 
13 
p 158 
C9H4NO2 
5 
r 152 
C8H8NO3 
14 
s 135 
C8H7O2 
7
		

/p0073.djvu

			4. Wyniki 
__________________________________________________________________________ 
67 
Rys. 27. Droga fragmentacji związku WP
		

/p0074.djvu

			4. Wyniki 
__________________________________________________________________________ 
68 
4.2.5. Analiza widm NMR 
4.2.5.1. Analiza widm 1H NMR 
Zarejestrowano widmo 1H NMR w DMSO-d6 oraz MeOH-d4. Jako wzorca 
wewnętrznego użyto TMS. Widma przedstawiono na rys. 28 - 33. Analiza widm 
znajduje się tab. 12. 
Rys. 28. Widmo 1H NMR związku WP zarejestrowane w DMSO-d6
		

/p0075.djvu

			4. Wyniki 
__________________________________________________________________________ 
69 
Rys. 29. Widmo 1H NMR związku WP zarejestrowane w DMSO-d6 dla zakresu 7,1-9,6 ppm 
Rys. 30. Widmo 1H NMR związku WP zarejestrowane w DMSO-d6 dla zakresu 3,65-4,25 ppm
		

/p0076.djvu

			4. Wyniki 
__________________________________________________________________________ 
70 
Rys. 31. Widmo 1H NMR związku WP zarejestrowane w MeOH-d4 (przy δ=4,60 ppm 
występuje sygnał nitrometanu)
		

/p0077.djvu

			4. Wyniki 
__________________________________________________________________________ 
71 
Rys. 32. Widmo 1H NMR związku WP zarejestrowane w MeOH-d4 dla zakresu 7,1-9,8 ppm 
Rys. 33. Widmo 1H NMR związku WP zarejestrowane w MeOH-d4 dla zakresu 3,75-4,35 ppm
		

/p0078.djvu

			4. Wyniki 
__________________________________________________________________________ 
72 
Tab. 12. Analiza widm 1H NMR związku WP zarejestrowanych w DMSO-d6 oraz w 
metanolu-d4 
Rozpuszczalnik 
MeOH-d4 
DMSO-d6 
Nr atomu 
wodoru 
δ 
[ppm] Rodzaj 
sygnału 
Ilość 
protonów 
δ 
[ppm] Rodzaj 
sygnału 
Ilość 
protonów 
1 
9,47 d(J=1,5Hz) 1 
9,55 d (J= 1,2 Hz) 
1 
3 
8,34 dd (J= 6,8 i 
1,5 Hz) 
1 
8,41 dd(J=6i1,5 
Hz) 
1 
4 
8,16 d(J=6,8Hz) 1 
8,39 dd(J=6i1,2 
Hz) 
1 
5 
7,64 
s 
1 
7,75 
s 
1 
8 
7,57 
s 
1 
7,57 
3' 
7,58 
s 
1 
7,57 
s 
sygnały się 
nakładają 
6' 
7,15 
s 
1 
7,21 
s 
1 
6-OCH3 
4,13 
s 
3 
4,07 
s 
3 
7-OCH3 
3,98 
s 
3 
3,94 
s 
3 
4'-OCH3 
3,96 
s 
3 
3,85 
s 
3 
5'-OCH3 
3,90 
s 
3 
3,81 
s 
3 
W przypadku widm zarejestrowanych w deuterowanym metanolu oraz w 
DMSO stwierdzono obecność 7 aromatycznych protonów oraz 12 protonów grup 
metoksylowych.
		

/p0079.djvu

			4. Wyniki 
__________________________________________________________________________ 
73 
4.2.5.2. Analiza widm 13C CP NMR 
Widmo 13C CP NMR wykonano w metanolu-d4. Jako wzorca użyto TMS. 
Widma przedstawiono na rys. 34 i 35 a wyniki analizy widm przedstawiono w tab. 13. 
Rys. 34. Widmo 13C CP NMR związku WP zarejestrowane w MeOH-d4 - zakres 100-170 ppm 
Rys. 35. Widmo 13C CP NMR związku WP zarejestrowane w MeOH-d4 -- zakres 56,4-57,8 ppm
		

/p0080.djvu

			4. Wyniki 
__________________________________________________________________________ 
74 
Tab. 13. Analiza widma 13C CP NMR związku WP 
Numer atomu węgla 
Przesunięcie 
chemiczne 
[ppm] 
Numer atomu węgla 
Przesunięcie 
chemiczne 
[ppm] 
1 
147,5 
2' 
128,24 
3 
136,27 
3' 
114,35 
4 
123,13 
4' 
151,32 
4a 
137,33 
5' 
151,49 
5 
106,38 
6' 
110,74 
6 
159,97 
6-OCH3 
57,52 
7 
154,35 
7-OCH3 
57,00 
8 
108,29 
4'-OCH3 
56,54 
8a 
125,09 
5'-OCH3 
56,95 
1' 
136,15 
2'-COO- 
170,29 
Analiza NMR wykazała obecność 20 atomów węgla.
		

/p0081.djvu

			4. Wyniki 
__________________________________________________________________________ 
75 
4.2.5.3. Analiza widma 13C DEPT NMR 
Widmo zostało zarejestrowane w metanolu-d4 (TMS został użyty jako wzorzec 
wewnętrzny). Przedstawiono je na rys. 36, a wyniki umieszczono w tab. 14. 
Rys. 36. Widmo 13C DEPT NMR
		

/p0082.djvu

			4. Wyniki 
__________________________________________________________________________ 
76 
Tab. 14. Analiza widma 13C DEPT NMR 
Rodzaj grupy 
Nr atomu węgla 
Sygnał [ppm] 
CH 
1 
147,50 
CH 
3 
136,27 
CH 
4 
123,13 
CH 
3' 
114,35 
CH 
6' 
110,74 
CH 
8 
106,29 
CH 
5 
106,38 
CH3 
6 
57,52 
CH3 
7 
57,00 
CH3 
2' 
56,95 
CH3 
5' 
56,94 
Analiza widma wykazała obecność 11 atomów węgla bezpośrednio 
związanych z atomami wodoru. Z atomami wodoru związane jest 7 atomów węgla 
układu pierścieni aromatycznych i 4 atomy węgla grup metoksylowych.
		

/p0083.djvu

			4. Wyniki 
__________________________________________________________________________ 
77 
4.2.5.4. Analiza widma 15N NMR 
Widmo zostało zarejestrowane w DMSO-d6. Wzorcem wewnętrznym jest 
nitrometan. 
Rys. 37. Widmo 15N związku WP 
Na widmie zarejestrowano jeden sygnał dla atomu azotu pochodzącego z 
układu izochinoliniowego.
		

/p0084.djvu

			4. Wyniki 
__________________________________________________________________________ 
78 
4.2.5.5. Analiza widm dwuwymiarowych NMR 
4.2.5.5.1. Widmo 1H,1H COSY LR 
Na rys. 38-40 przedstawiono widma 1H,1H COSY LR. W tab. 15. umieszczono 
analizę widma. 
Rys. 38. Widmo 1H,1H COSY LR związku WP
		

/p0085.djvu

			4. Wyniki 
__________________________________________________________________________ 
79 
Rys. 39. Widmo 1H,1H COSY LR związku WP - zakres 7,5-9,5 ppm x 7,5-9,5 ppm 
Rys. 40. Widmo 1H,1H COSY LR związku WP - zakres 7,1-7,7 ppm x 3,95 -- 4,15 ppm
		

/p0086.djvu

			4. Wyniki 
__________________________________________________________________________ 
80 
Tab. 15. Analiza widma 1H,1H COSY LR związku WP (w nawiasie zaznaczono słaby sygnał 
korelacji) 
Proton 
Korelacja 1H,1H COSY LR 
9,47 
8,34; (8,16); 7,64 
8,34 
8,16 
8,16 
8,34; 7,57 
7,64 
8,34; 4,13 
7,57 
8,16; 3,98 
7,58 
3,96; 7,15 
7,15 
7,58; 3,90 
4,13 
7,64 
3,98 
7,57 
3,96 
7,58 
3,90 
7,15
		

/p0087.djvu

			4. Wyniki 
__________________________________________________________________________ 
81 
4.2.5.5.2. Widmo 1H,13C HMBC NMR 
Rys. 41. Widmo 1H,13C HMBC NMR związku WP 
Rys. 42. Widmo 1H,13C HMBC NMR związku WP (zakres 3,4-4,2 ppm x 151-160 ppm)
		

/p0088.djvu

			4. Wyniki 
__________________________________________________________________________ 
82 
Rys. 43. Widmo 1H,13C HMBC NMR związku WP (zakres 3,76-4,2 ppm x 106-115 ppm)
		

/p0089.djvu

			4. Wyniki 
__________________________________________________________________________ 
83 
Rys. 44. Widmo 1H,13C HMBC NMR związku WP (zakres 7,5-9,5 ppm x 104-170 ppm) 
Tab. 16. Analiza widma 1H,13C HMBC NMR związku WP 
Proton 
Korelacja 1H do13C HMBC 
9,47 
136,15; (136,27); 137,33; 108,29; 125,09 
8,34 
147,5; 136,15; 123,13; 137,33; (159,97); (125,09) 
8,16 
(147,5); 136,27; 106,38; (108,29); 125,09 
7,64 
(147,5); 123,13; 159,97; 154,35; 125,09 
7,57 
147,5; (123,13); 137,33; (106,38); 159,97; 154,35 
7,58 
136,15; 128,24; 170,29; 151,32; 151,49; 110,74 
7,15 
136,15; 128,24; 170,29; (114,35), 151,32; 151,49 
4,13 
106,38; 159,97 
3,98 
154,35; 108,29 
3,96 
114,35; 151,32 
3,90 
151,49; 110,74 
4.2.5.5.3. Widmo 1H,15N HMBC NMR 
Widmo zostało zarejestrowane w DMSO-d6. 
Rys. 45. Widmo 1H,15N HMBC NMR związku WP. 
Na widmie można zaobserwować korelację atomu azotu z protonami 9,47 
ppm, 8,34 ppm, 8,16 ppm, 7,58 ppm oraz 7,15 ppm.
		

/p0090.djvu

			4. Wyniki 
__________________________________________________________________________ 
84 
4.2.5.5.4. Widmo 1H,13C HSQC NMR 
Widmo zostało zarejestrowane w metanolu-d4. 
Rys. 46. Widmo 1H,13C HSQC NMR związku WP - zakres 7,5-9,5 ppm x 104-160 ppm 
Rys. 47. Widmo 1H,13C HSQC NMR związku WP zakres 3,90-4,15 ppm x 56-58 ppm
		

/p0091.djvu

			4. Wyniki 
__________________________________________________________________________ 
85 
Analizę korelacji 1H-13C przedstawiono w tab. 17. 
Tab. 17. Korelacja 1H-13C HSQC NMR związku WP 
Przesunięcie chemiczne 
protonu [ppm] 
Przesunięcie chemiczne atomu 
węgla [ppm] 
9,47 
147,5 
8,34 
136,27 
8,16 
123,13 
7,64 
106,38 
7,57 
108,29 
7,58 
114,35 
7,15 
110,74 
4,13 
57,52 
3,98 
57,00 
3,96 
56,54 
3,90 
56,95 
Widmo 1H-13C HSQC NMR potwierdziło obecność 11 atomów węgla 
połączonych bezpośrednio z protonami.
		

/p0092.djvu

			4. Wyniki 
__________________________________________________________________________ 
86 
4.2.5.5.5. Widmo 1H,1H NOESY NMR 
Widmo zostało zarejestrowane w metanolu-d4. 
Rys. 48. Widmo 1H,1H NOESY NMR związku WP -- zakres 7,0-9,6 ppm x 6,9-9,7 ppm 
Rys. 49. Widmo 1H,1H NOESY NMR związku WP -- zakres 3,88-4,14 ppm x 7,16-7,64 ppm
		

/p0093.djvu

			4. Wyniki 
__________________________________________________________________________ 
87 
Tab. 18. Analiza widma 1H,1H NOESY NMR związku WP 
Przesunięcie chemiczne 
protonu [ppm] 
Sygnał korelacji 1H,1H NOESY 
9,47 
7,15, 7,57 
8,34 
7,15 
8,16 
7,64 
7,64 
8,16, 4,13 
7,57 
3,98 
7,58 
3,96 
7,15 
3,90 
4,13 
7,64 
3,98 
7,57 
3,96 
7,58 
3,90 
7,15
		

/p0095.djvu

			4. Wyniki 
__________________________________________________________________________ 
89 
Tab. 19. Zależność absorbancji przy λmax = 310 nm od stężenia związku X w roztworze dla 
trzech krzywych wzorcowych z uwzględnieniem przedziału ufności dla poziomu istotności α = 
0,05 
Absorbancja 
Stężenie [ M ] 
Krzywa 
wzorcowa 1 Krzywa 
wzorcowa 2 Krzywa 
wzorcowa 3 
Wartość 
średnia ± SD Przedział 
ufności dla 
α=0,05 
3,541E-06 
0,147 
0,124 
0,129 
0,133 ± 0,012 
0,030 
7,073E-06 
0,278 
0,260 
0,264 
0,267 ± 0,009 
0,023 
1,059E-05 
0,415 
0,395 
0,401 
0,404 ± 0,010 
0,025 
1,762E-05 
0,688 
0,672 
0,676 
0,678 ± 0,008 
0,021 
2,460E-05 
0,970 
0,944 
0,946 
0,953 ± 0,015 
0,037 
2,808E-05 
1,115 
1,086 
1,087 
1,096 ± 0,017 
0,041 
0 
0,2 
0,4 
0,6 
0,8 
1 
1,2 
0,00E+00 5,00E-06 1,00E-05 1,50E-05 2,00E-05 2,50E-05 3,00E-05 
Stężenie [M] 
Absorbancja
Rys. 50. Wykres krzywej wzorcowej dla chlorku brunatnego związku X jako zależność 
średnich absorbancji przy λmax = 310 nm od jego stężenia
		

/p0096.djvu

			4. Wyniki 
__________________________________________________________________________ 
90 
4.3.1.1.2. Związek WP 
Wartości średnie zawartości białego związku WP otrzymano przeprowadzając 
po trzy pomiary absorbancji przy λ = 256 nm dla każdego z sześciu stężeń z zakresu 
1,892 10-6 -- 1,488 10-5 M. Korzystając z metody najmniejszych kwadratów 
uzyskano prostą, która zgodnie z prawem Lamberta -- Beera, opisana jest przez 
następujące równanie liniowe: 
A=85565 c 
gdzie: A -- absorbancja roztworu, c -- stężenie molowe białego związku WP 
Współczynnik korelacji liniowej wynosił r = 0,9995, co oznacza liniowy 
przebieg krzywej wzorcowej w zakresie badanych stężeń, z uwzględnieniem rozkładu 
normalnego. Wartości odchyleń standardowych dla poszczególnych stężeń mieszczą 
się w obliczonym przedziale ufności dla poziomu istotności α = 0,05. 
Parametry precyzji mieściły się w zakresie 2,40 - 5,32% dla oznaczenia 
"interday" a dla oznaczenia "intraday" 3,40 - 6,12%. Dokładność wyniosła 0,06 -- 
3,03% dla oznaczenia "interday" a dla "intraday" 0,63 - 4,77%. 
Wartości dla poszczególnych punktów krzywej wzorcowej (rys. 51) są 
przedstawione w tab. 20. 
Tab. 20. Zależność absorbancji przy λmax = 256 nm od stężenia związku WP w roztworze dla 
trzech krzywych wzorcowych z uwzględnieniem przedziału ufności dla poziomu istotności α = 
0,05 
Absorbancja 
Stężenie [ M ] Krzywa 
wzorcowa 1 Krzywa 
wzorcowa 2 Krzywa 
wzorcowa 3 
Wartość 
średnia ± SD Przedział 
ufności dla 
α=0,05 
1,892E-06 
0,146 
0,163 
0,148 0,148 ± 0,009 0,023 
3,775E-06 
0,336 
0,350 
0,323 0,336 ± 0,014 0,034 
7,513E-06 
0,630 
0,600 
0,642 0,624 ± 0,021 0,053 
9,368E-06 
0,776 
0,841 
0,801 0,806 ± 0,032 0,081 
1,121E-05 
0,934 
0,995 
0,989 0,973 ± 0,034 0,083 
1,488E-05 
1,218 
1,311 
1,274 
1,268 ± 0,047 0,116
		

/p0097.djvu

			4. Wyniki 
__________________________________________________________________________ 
91 
0 
0,2 
0,4 
0,6 
0,8 
1 
1,2 
1,4 
0,00E+00 5,00E-06 1,00E-05 1,50E-05 2,00E-05 
Stężenie [M] 
Absorbancja
Rys. 51. Wykres średniej krzywej wzorcowej dla białego związku WP jako zależność 
absorbancji przy λmax = 256 nm od jego stężenia
		

/p0098.djvu

			4. Wyniki 
__________________________________________________________________________ 
92 
4.3.2. Wyniki pomiarów kinetycznych dla poszczególnych 
temperatur 
4.3.2.1. Temperatura 313 K 
4.3.2.1.1. Pomiary dla ubytku substratu 
• 0,1MNaOH 
Tab. 21. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu NaOH o stężeniu 0,1 M w temperaturze 313 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
0 
0,176 
4,729E-06 
30 
0,169 
4,553E-06 
60 
0,155 
4,201E-06 
90 
0,154 
4,163E-06 
120 
0,144 
3,902E-06 
150 
0,137 
3,724E-06 
180 
0,135 
3,681E-06 
y = 5E-06e-0,0015x 
R2 = 0,9722 
1,00E-06 
1,00E-05 
0 
50 
100 
150 
200 
Czas [min] 
Stężenie [M]
Rys. 52. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu, dla badanej 
reakcji przy użyciu NaOH o stężeniu 0,1 M w temperaturze 313 K
		

/p0099.djvu

			4. Wyniki 
__________________________________________________________________________ 
93 
• 0,1MKOH 
Tab. 22. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu KOH o stężeniu 0,1 M w temperaturze 313 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
0 
0,207 
5,517E-06 
30 
0,173 
4,645E-06 
60 
0,160 
4,326E-06 
90 
0,157 
4,249E-06 
120 
0,147 
3,976E-06 
150 
0,140 
3,800E-06 
180 
0,138 
3,744E-06 
y = 5E-06e-0,002x 
R2 = 0,8928 
1,00E-06 
1,00E-05 
0 
50 
100 
150 
200 
Czas [min] 
Stężenie [M]
Rys. 53. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu, dla badanej 
reakcji przy użyciu KOH o stężeniu 0,1 M w temperaturze 313 K
		

/p0100.djvu

			4. Wyniki 
__________________________________________________________________________ 
94 
• 0,1MLiOH 
Tab. 23. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu LiOH o stężeniu 0,1 M w temperaturze 313 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
0 
0,177 
4,759E-06 
30 
0,157 
4,247E-06 
60 
0,154 
4,170E-06 
90 
0,147 
3,974E-06 
120 
0,139 
3,780E-06 
150 
0,138 
3,744E-06 
180 
0,117 
3,227E-06 
y = 5E-06e-0,0018x 
R2 = 0,9265 
1,00E-06 
1,00E-05 0 
50 
100 
150 
200 
Czas [min] 
Absorbancja
Rys. 54. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu, dla badanej 
reakcji przy użyciu LiOH o stężeniu 0,1 M w temperaturze 313 K
		

/p0101.djvu

			4. Wyniki 
__________________________________________________________________________ 
95 
4.3.2.1.2. Pomiary dla przyrostu stężenia produktu 
• 0,1MNaOH 
B∞ = 0,636; c∞ = 7,434E-06 M 
Tab. 24. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu NaOH o stężeniu 0,1 M w temperaturze 313 K 
Czas [min] Absorbancja B Stężenie c 
[M] c∞ -c[M] 
0 
0,522 
6,104E-06 1,330E-06 
30 
0,554 
6,483E-06 9,505E-07 
60 
0,560 
6,547E-06 8,864E-07 
90 
0,580 
6,781E-06 6,531E-07 
120 
0,602 
7,037E-06 3,966E-07 
150 
0,606 
7,084E-06 3,499E-07 
y = 1E-06e-0,0091x 
R2 = 0,9645 
1,00E-07 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
140 
160 
Rys. 55. Wykres półlogarytmiczny zmiany różnicy stężeń (c∞ - c) białego związku WP od 
czasu dla badanej reakcji przy użyciu NaOH o stężeniu 0,1 M w temperaturze 313 K
		

/p0102.djvu

			4. Wyniki 
__________________________________________________________________________ 
96 
• 0,1MKOH 
B∞ = 0,566; c∞ = 6,623E-06 M 
Tab. 25. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu KOH o stężeniu 0,1 M w temperaturze 313 K 
Czas [min] Absorbancja B Stężenie c 
[M] 
c∞-c [M] 
0 
0,449 
5,257E-06 1,366E-06 
30 
0,499 
5,837E-06 7,860E-07 
60 
0,514 
6,021E-06 6,018E-07 
90 
0,550 
6,431E-06 1,924E-07 
120 
0,556 
6,507E-06 1,166E-07 
150 
0,560 
6,547E-06 7,578E-08 
y = 1E-06e-0,0203x 
R2 = 0,9745 
1,00E-08 
1,00E-07 
1,00E-06 
1,00E-05 
0 
20 
40 
60 
80 
100 
120 
140 
160 
Rys. 56. Wykres półlogarytmiczny zmiany różnicy stężeń (c∞ - c) białego związku WP od 
czasu dla badanej reakcji przy użyciu KOH o stężeniu 0,1 M w temperaturze 313 K
		

/p0103.djvu

			4. Wyniki 
__________________________________________________________________________ 
97 
• 0,1MLiOH 
B∞ = 0,638; c∞ = 7,463E-06 M 
Tab. 26. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu LiOH o stężeniu 0,1 M w temperaturze 313 K 
Czas [min] Absorbancja B Stężenie c 
[M] 
c∞ -c[M] 
0 
0,523 
6,118E-06 1,345E-06 
30 
0,557 
6,512E-06 9,505E-07 
60 
0,561 
6,564E-06 8,992E-07 
90 
0,583 
6,824E-06 6,391E-07 
120 
0,601 
7,034E-06 4,292E-07 
150 
0,619 
7,241E-06 2,216E-07 
y = 1E-06e-0,0112x 
R2 = 0,9345 
1,00E-07 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
140 
160 
Rys. 57. Wykres półlogarytmiczny zmiany różnicy stężeń (c∞ - c) białego związku WP od 
czasu, dla badanej reakcji przy użyciu LiOH o stężeniu 0,1 M w temperaturze 313 K
		

/p0104.djvu

			4. Wyniki 
__________________________________________________________________________ 
98 
4.3.2.2. Temperatura 323 K 
4.3.2.2.1. Pomiary dla ubytku substratu 
• 0,1MNaOH 
Tab. 27. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu NaOH o stężeniu 0,1 M w temperaturze 323 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
15 
0,173 
4,652E-06 
30 
0,160 
4,318E-06 
45 
0,154 
4,170E-06 
60 
0,150 
4,053E-06 
75 
0,138 
3,749E-06 
90 
0,137 
3,724E-06 
105 
0,136 
3,703E-06 
y = 5E-06e-0,0026x 
R2 = 0,9345 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
Czas [min] 
Stężenie [M]
Rys. 58. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu dla badanej 
reakcji przy użyciu NaOH o stężeniu 0,1 M w temperaturze 323 K
		

/p0105.djvu

			4. Wyniki 
__________________________________________________________________________ 
99 
• 0,1MKOH 
Tab. 28 Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu KOH o stężeniu 0,1 M w temperaturze 323 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
15 
0,185 
4,963E-06 
30 
0,178 
4,772E-06 
45 
0,171 
4,589E-06 
60 
0,162 
4,372E-06 
75 
0,147 
3,992E-06 
90 
0,148 
4,010E-06 
105 
0,141 
3,828E-06 
y = 5E-06e-0,003x 
R2 = 0,9681 
1,00E-06 
1,00E-05 
0 
20 
40 
60 
80 
100 
120 
Czas [min] 
Stężenie [M]
Rys. 59. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu dla badanej 
reakcji przy użyciu KOH o stężeniu 0,1 M w temperaturze 323 K
		

/p0106.djvu

			4. Wyniki 
__________________________________________________________________________ 
100 
• 0,1MLiOH 
Tab. 29. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu zasady LiOH o stężeniu 0,1 M w temperaturze 323 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
15 
0,148 
4,012E-06 
30 
0,145 
3,936E-06 
45 
0,141 
3,834E-06 
60 
0,129 
3,522E-06 
75 
0,127 
3,484E-06 
90 
0,127 
3,471E-06 
105 
0,123 
3,385E-06 
y = 4E-06e-0,002x 
R2 = 0,9144 
1,00E-06 
1,00E-05 
0 
20 
40 
60 
80 
100 
120 
Czas [min] 
Stężenie [M]
Rys. 60. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu dla badanej 
reakcji przy użyciu LiOH o stężeniu 0,1 M w temperaturze 323 K
		

/p0107.djvu

			4. Wyniki 
__________________________________________________________________________ 
101 
4.3.2.2.2. Pomiary dla przyrostu produktu 
• 0,1MNaOH 
B∞ = 0,673; c∞ = 7,871E-06 M 
Tab. 30. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu NaOH o stężeniu 0,1 M w temperaturze 323 K 
Czas 
[min] Absorbancja B Stężenie c [M] c∞ - c [M] 
15 
0,590 
6,90E-06 
9,74E-07 
30 
0,614 
7,18E-06 
6,94E-07 
45 
0,635 
7,42E-06 
4,49E-07 
60 
0,640 
7,49E-06 
3,85E-07 
75 
0,645 
7,54E-06 
3,32E-07 
90 
0,645 
7,55E-06 
3,27E-07 
105 
0,649 
7,59E-06 
2,86E-07 
y = 1E-06e-0,0131x 
R2 = 0,8896 
1,00E-07 
1,00E-06 0 
20 
40 
60 
80 
100 
120 
Czas [min] 
Stężenie c∞ - c [M]
Rys. 61. Wykres półlogarytmiczny zmiany różnicy stężeń białego związku WP od czasu, dla 
badanej reakcji przy użyciu zasady NaOH o stężeniu 0,1 M w temperaturze 323 K
		

/p0108.djvu

			4. Wyniki 
__________________________________________________________________________ 
102 
• 0,1MKOH 
B∞ = 0,638; c∞= 7,457E-06 M 
Tab. 31. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu KOH o stężeniu 0,1 M w temperaturze 323 K 
Czas [min] Absorbancja B Stężenie c 
[M] 
c∞ -c[M] 
15 
0,498 
5,829E-06 1,628E-06 
30 
0,525 
6,139E-06 1,318E-06 
45 
0,546 
6,384E-06 1,073E-06 
60 
0,605 
7,078E-06 3,790E-07 
75 
0,614 
7,177E-06 2,799E-07 
90 
0,615 
7,195E-06 2,624E-07 
105 
0,623 
7,282E-06 1,749E-07 
y = 3E-06e-0,0268x 
R2 = 0,9383 
1,00E-07 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
Czas [min] 
Stężenie c∞ - c [M]
Rys. 62. Wykres półlogarytmiczny zmiany różnicy stężeń białego związku WP od czasu, dla 
badanej reakcji przy użyciu zasady KOH o stężeniu 0,1 M w temperaturze 323 K
		

/p0109.djvu

			4. Wyniki 
__________________________________________________________________________ 
103 
• 0,1MLiOH 
B∞ = 0,583; c∞ = 6,821E-06 M 
Tab. 32. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu LiOH o stężeniu 0,1 M w temperaturze 323 K 
Czas [min] Absorbancja B 
Stężenie c 
[M] 
c∞ -c[M] 
15 
0,442 
5,182E-06 1,640E-06 
30 
0,463 
5,417E-06 1,404E-06 
45 
0,461 
5,395E-06 1,426E-06 
60 
0,468 
5,474E-06 1,347E-06 
75 
0,521 
6,098E-06 7,231E-07 
90 
0,534 
6,250E-06 5,715E-07 
105 
0,535 
6,262E-06 5,598E-07 
y = 2E-06e-0,0136x 
R2 = 0,8734 
1,00E-07 
1,00E-06 
1,00E-05 
0 
20 
40 
60 
80 
100 
120 
Czas [M] 
Stężenie c∞ - c [M]
Rys. 63. Wykres półlogarytmiczny zmiany różnicy stężeń białego związku WP od czasu dla 
badanej reakcji przy użyciu LiOH o stężeniu 0,1 M w temperaturze 323 K
		

/p0110.djvu

			4. Wyniki 
__________________________________________________________________________ 
104 
4.3.2.3. Temperatura 333 K 
4.3.2.3.1. Pomiary dla ubytku substratu 
• 0,1MNaOH 
Tab. 33. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu NaOH o stężeniu 0,1 M w temperaturze 333 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
15 
0,227 
6,022E-06 
30 
0,210 
5,601E-06 
45 
0,191 
5,119E-06 
60 
0,182 
4,884E-06 
75 
0,169 
4,538E-06 
90 
0,158 
4,272E-06 
105 
0,159 
4,288E-06 
y = 6E-06e-0,004x 
R2 = 0,9643 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
Czas [M] 
Stężenie [M]
Rys. 64. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu dla badanej 
reakcji przy użyciu NaOH o stężeniu 0,1 M w temperaturze 333 K
		

/p0111.djvu

			4. Wyniki 
__________________________________________________________________________ 
105 
• 0,1MKOH 
Tab. 34. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu KOH o stężeniu 0,1 M w temperaturze 333 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
15 
0,217 
5,767E-06 
30 
0,193 
5,155E-06 
45 
0,165 
4,456E-06 
60 
0,154 
4,175E-06 
75 
0,143 
3,890E-06 
90 
0,138 
3,744E-06 
105 
0,137 
3,732E-06 
y = 6E-06e-0,005x 
R2 = 0,9151 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
Czas [M] 
Stężenie [M]
Rys. 65. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu, c = f (t), dla 
badanej reakcji przy użyciu KOH o stężeniu 0,1 M w temperaturze 333 K
		

/p0112.djvu

			4. Wyniki 
__________________________________________________________________________ 
106 
• 0,1MLiOH 
Tab. 35. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu LiOH o stężeniu 0,1 M w temperaturze 333 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
15 
0,143 
3,882E-06 
30 
0,132 
3,601E-06 
45 
0,128 
3,502E-06 
60 
0,117 
3,219E-06 
75 
0,113 
3,130E-06 
90 
0,111 
3,068E-06 
105 
0,103 
2,872E-06 
y = 4E-06e-0,0032x 
R2 = 0,9742 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
Czas [M] 
Stężenie [M]
Rys. 66. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu, c = f (t), dla 
badanej reakcji przy użyciu LiOH o stężeniu 0,1 M w temperaturze 333 K
		

/p0113.djvu

			4. Wyniki 
__________________________________________________________________________ 
107 
4.3.2.3.2. Pomiary dla przyrostu produktu 
• 0,1MNaOH 
B∞ = 0,797; c∞ = 9,311E-06 M 
Tab. 36. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu NaOH o stężeniu 0,1 M w temperaturze 333 K 
Czas [min] Absorbancja B Stężenie c [M] c∞ - c [M] 
15 
0,590 
6,90E-06 
2,41E-06 
30 
0,618 
7,22E-06 
2,09E-06 
45 
0,668 
7,81E-06 
1,50E-06 
60 
0,722 
8,44E-06 
8,69E-07 
75 
0,728 
8,51E-06 
7,99E-07 
90 
0,759 
8,87E-06 
4,43E-07 
105 
0,767 
8,96E-06 
3,50E-07 
y = 4E-06e-0,0227x 
R2 = 0,9779 
1,00E-07 
1,00E-06 
1,00E-05 
0 
20 
40 
60 
80 
100 
120 
Czas [M] 
Stężenie c∞ - c [M]
Rys. 67. Wykres półlogarytmiczny zmiany różnicy stężeń białego związku WP od czasu dla 
badanej reakcji przy użyciu NaOH o stężeniu 0,1 M w temperaturze 333 K
		

/p0114.djvu

			4. Wyniki 
__________________________________________________________________________ 
108 
• 0,1MKOH 
B∞ = 0,586; c∞ = 6,851E-06 M 
Tab. 37. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu KOH o stężeniu 0,1 M w temperaturze 333 K. 
Czas [min] Absorbancja B Stężenie c [M] c∞ - c [M] 
15 
0,400 
4,690E-06 2,161E-06 
30 
0,460 
5,387E-06 1,464E-06 
45 
0,492 
5,761E-06 1,089E-06 
60 
0,526 
6,151E-06 6,997E-07 
75 
0,537 
6,279E-06 5,714E-07 
90 
0,574 
6,711E-06 1,399E-07 
105 
0,580 
6,781E-06 6,993E-08 
y = 5E-06e-0,0372x 
R2 = 0,9205 
1,00E-08 
1,00E-07 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
Czas [M] 
Stężenie c∞ - c [M]
Rys. 68. Wykres półlogarytmiczny zmiany różnicy stężeń białego związku WP od czasu dla 
badanej reakcji przy użyciu KOH o stężeniu 0,1 M w temperaturze 333 K
		

/p0115.djvu

			4. Wyniki 
__________________________________________________________________________ 
109 
• 0,1MLiOH 
B∞ = 0,590; c∞ = 6,907E-06 M 
Tab. 38. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu LiOH o stężeniu 0,1 M w temperaturze 333 K 
Czas [min] Absorbancja B Stężenie c [M] c∞ - c [M] 
15 
0,476 
5,568E-06 
1,339E-06 
30 
0,517 
6,046E-06 
8,607E-07 
45 
0,549 
6,425E-06 
4,816E-07 
60 
0,552 
6,454E-06 
4,525E-07 
75 
0,561 
6,559E-06 
3,475E-07 
90 
0,573 
6,699E-06 
2,076E-07 
105 
0,577 
6,746E-06 
1,609E-07 
y = 2E-06e-0,0227x 
R2 = 0,9739 
1,00E-07 
1,00E-06 
1,00E-05 0 
20 
40 
60 
80 
100 
120 
Czas [M] 
Stężenie c∞ - c [M]
Rys. 69. Wykres półlogarytmiczny zmiany różnicy stężeń (c∞ - c) białego związku WP od 
czasu, (c∞ -- c) = f (t), dla badanej reakcji przy użyciu LiOH o stężeniu 0,1 M w temperaturze 
333 K
		

/p0116.djvu

			4. Wyniki 
__________________________________________________________________________ 
110 
4.3.2.4. Temperatura 343 K 
4.3.2.4.1. Pomiary dla ubytku substratu 
• 0,1MNaOH 
Tab. 39. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu NaOH o stężeniu 0,1 M w temperaturze 343 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
10 
0,320 
8,407E-06 
20 
0,275 
7,254E-06 
30 
0,257 
6,782E-06 
40 
0,245 
6,486E-06 
50 
0,240 
6,351E-06 
60 
0,222 
5,905E-06 
y = 9E-06e-0,0063x 
R2 = 0,9184 
1,00E-06 
1,00E-05 
0 
10 
20 
30 
40 
50 
60 
70 
Czas [M] 
Stężenie [M]
Rys. 70. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu dla badanej 
reakcji przy użyciu NaOH o stężeniu 0,1 M w temperaturze 343 K
		

/p0117.djvu

			4. Wyniki 
__________________________________________________________________________ 
111 
• 0,1MKOH 
Tab. 40. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu KOH o stężeniu 0,1 M w temperaturze 343 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
10 
0,170 
4,583E-06 
20 
0,157 
4,249E-06 
30 
0,137 
3,724E-06 
40 
0,133 
3,617E-06 
50 
0,130 
3,558E-06 
60 
0,122 
3,346E-06 
y = 5E-06e-0,0061x 
R2 = 0,9204 
1,00E-06 
1,00E-05 0 
10 
20 
30 
40 
50 
60 
70 
Czas [M] 
Stężenie [M]
Rys. 71. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu dla badanej 
reakcji przy użyciu KOH o stężeniu 0,1 M w temperaturze 343 K
		

/p0118.djvu

			4. Wyniki 
__________________________________________________________________________ 
112 
• 0,1MLiOH 
Tab. 41. Wyniki pomiarów ubytku chlorku brunatnego związku X wraz z upływem czasu po 
dodaniu LiOH o stężeniu 0,1 M w temperaturze 343 K 
Czas [min] 
Absorbancja 
Stężenie c [M] 
10 
0,127 
3,484E-06 
20 
0,124 
3,408E-06 
30 
0,120 
3,300E-06 
40 
0,112 
3,099E-06 
50 
0,109 
3,005E-06 
60 
0,105 
2,923E-06 
y = 4E-06e-0,0038x 
R2 = 0,9807 
1,00E-06 
1,00E-05 0 
10 
20 
30 
40 
50 
60 
70 
Czas [M] 
Stężenie [M]
Rys. 72. Wykres półlogarytmiczny zmiany stężenia chlorku związku X od czasu dla badanej 
reakcji przy użyciu LiOH o stężeniu 0,1 M w temperaturze 343 K
		

/p0119.djvu

			4. Wyniki 
__________________________________________________________________________ 
113 
4.3.2.4.2. Pomiary dla przyrostu produktu 
• 0,1MNaOH 
B∞ = 0,615; c∞ = 7,189 E-06 M 
Tab. 42. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu NaOH o stężeniu 0,1 M w temperaturze 343 K 
Czas [min] Absorbancja B Stężenie c [M] c∞ - c [M] 
10 
0,436 
5,111E-06 2,078E-06 
20 
0,476 
5,570E-06 1,619E-06 
30 
0,477 
5,588E-06 1,601E-06 
40 
0,535 
6,262E-06 9,272E-07 
50 
0,560 
6,553E-06 6,357E-07 
60 
0,570 
6,670E-06 5,190E-07 
y = 3E-06e-0,0294x 
R2 = 0,9519 
1,00E-07 
1,00E-06 
1,00E-05 0 
10 
20 
30 
40 
50 
60 
70 
Czas [M] 
Stężenie c∞ - c [M]
Rys. 73. Wykres półlogarytmiczny zmiany różnicy stężeń (c∞ - c) białego związku WP od 
czasu dla badanej reakcji przy użyciu NaOH o stężeniu 0,1 M w temperaturze 343 K
		

/p0120.djvu

			4. Wyniki 
__________________________________________________________________________ 
114 
• 0,1MKOH 
B∞ = 0,614; c∞ = 7,177E-06 M 
Tab. 43. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu KOH o stężeniu 0,1 M w temperaturze 343 K 
Czas [min] Absorbancja B Stężenie c [M] c∞ - c [M] 
10 
0,519 
6,069E-06 
1,108E-06 
20 
0,548 
6,413E-06 
7,639E-07 
30 
0,577 
6,751E-06 
4,257E-07 
40 
0,589 
6,886E-06 
2,916E-07 
50 
0,598 
6,991E-06 
1,866E-07 
60 
0,610 
7,136E-06 
4,082E-08 
y = 3E-06e-0,0603x 
R2 = 0,922 
1,00E-08 
1,00E-07 
1,00E-06 
1,00E-05 0 
10 
20 
30 
40 
50 
60 
70 
Czas [M] 
Stężenie c∞ - c [M]
Rys. 74. Wykres półlogarytmiczny zmiany różnicy stężeń (c∞ - c) białego związku WP od 
czasu dla badanej reakcji przy użyciu KOH o stężeniu 0,1 M w temperaturze 343 K
		

/p0121.djvu

			4. Wyniki 
__________________________________________________________________________ 
115 
• 0,1MLiOH 
B∞ = 0,683; c∞ = 7,988E-06 M 
Tab. 44. Wyniki pomiarów przyrostu stężenia białego związku WP wraz z upływem czasu po 
dodaniu LiOH o stężeniu 0,1 M w temperaturze 343 K 
Czas [min] Absorbancja B Stężenie c [M] c∞ - c [M] 
10 
0,472 
5,525E-06 2,463E-06 
20 
0,497 
5,815E-06 2,173E-06 
30 
0,519 
6,075E-06 1,913E-06 
40 
0,562 
6,571E-06 1,417E-06 
50 
0,592 
6,926E-06 1,061E-06 
60 
0,617 
7,218E-06 7,697E-07 
y = 3E-06e-0,0236x 
R2 = 0,9661 
1,00E-07 
1,00E-06 
1,00E-05 
0 
10 
20 
30 
40 
50 
60 
70 
Czas [M] 
Stężenie [M]
Rys. 75. Wykres półlogarytmiczny zmiany różnicy stężeń (c∞ - c) białego związku WP od 
czasu dla badanej reakcji przy użyciu LiOH o stężeniu 0,1 M w temperaturze 343 K
		

/p0122.djvu

			4. Wyniki 
__________________________________________________________________________ 
116 
4.3.3. Zastosowanie równania Arrheniusa 
Tab. 45. Zestawienie stałych szybkości reakcji rozkładu chlorku związku X (k) w 
poszczególnych temperaturach. 
T [K] 1/T 
[10-3 
1/K] 
105 (kNaOH ± 
Δ kNaOH ) 
[s-1] 
lnkNaOH 105 (kKOH ± 
Δ kKOH) 
[s-1] lnkKOH 
105 (kLiOH ± 
Δ kLiOH) 
[s-1] lnkLiOH 
313 3,194888 2,50 
± 0,18 -10,5966 
3,33 
± 0,50 -10,3090 3,00 
± 0,37 -10,4143 
323 3,095975 4,33 
± 0,52 -10,0466 
5,00 
± 0,40 -9,9035 
3,33 
± 0,47 -10,3090 
333 3,003003 6,67 
± 0,50 
-9,6158 
8,33 
± 1,17 -9,3927 
5,33 
± 0,33 -9,8389 
343 2,915452 10,50 
± 1,57 
-9,1616 
10,17 
± 1,48 -9,1938 
6,33 
± 0,43 -9,6671 
y = -5087,8x + 5,6746 
R2 = 0,9988 
y = -2904,9x - 1,1907 
R2 = 0,9371 
y = -4151,2x + 2,971 
R2 = 0,9801 
-10,8 
-10,6 
-10,4 
-10,2 
-10 
-9,8 
-9,6 
-9,4 
-9,2 
-9 
0,0029 0,003 0,003 0,0031 0,0031 0,0032 0,0032 0,0033 
1/T [1/K] 
lnk
NaOH 
KOH 
LiOH 
Rys. 76. Wykres zależności logarytmu naturalnego ze stałej szybkości reakcji rozkładu 
chlorku związku X od odwrotności temperatury bezwzględnej, lnk = f (1/T)
		

/p0123.djvu

			4. Wyniki 
__________________________________________________________________________ 
117 
Tab. 46. Zestawienie stałych szybkości reakcji (k) tworzenia związku WP z chlorku X w 
poszczególnych temperaturach. 
T [K] 1/T 
[10-3 ·1/K] 
104 (kNaOH ± 
Δ kNaOH) 
[s-1] 
lnkNaOH 104 (kKOH ± 
Δ kKOH) 
[s-1] lnkKOH 
104 (kLiOH ± 
Δ kLiOH) 
[s-1] lnkLiOH 
313 3,194888 
1,52 
± 0,15 -8,7938 
3,38 
± 0,27 -7,9915 
1,87 
± 0,25 -8,5862 
323 3,095975 
2,18 
± 0,35 -8,4295 
4,47 
± 0,52 -7,7137 
2,27 
± 0,38 -8,3920 
333 3,003003 
3,78 
± 0,25 -7,8797 
6,20 
± 0,82 -7,3858 
3,78 
± 0,28 -7,8797 
343 2,915452 
4,90 
± 0,55 -7,6211 
10,05 
± 1,47 -6,9028 
3,93 
± 0,37 -7,8409 
y = -3843x + 4,2315 
R2 = 0,9756 
y = -4371,5x + 5,1621 
R2 = 0,9854 
y = -2958,5x + 0,8556 
R2 = 0,9153 
-9,5 
-9 
-8,5 
-8 
-7,5 
-7 
-6,5 
-6 
0,0029 0,00295 0,003 0,00305 0,0031 0,00315 0,0032 0,00325 
1/T [1/K] 
lnk
NaOH 
KOH 
LiOH 
Rys. 77. Wykres zależności logarytmu naturalnego ze stałej szybkości reakcji tworzenia 
związku WP od odwrotności temperatury bezwzględnej, lnk = f (1/T). 
Wykres lnk = f(1/T) jest linią prostą, której współczynnik kierunkowy jest 
charakterystyczny dla danej reakcji, co przedstawiają wykresy na rys. 76 i 77. 
Energie aktywacji Ea wyliczone zostały z równania Arrheniusa dla substratu i 
produktu według wzoru: 
R 
a 
Ea 
× 
- 
= 
gdzie: 
Ea -- energia aktywacji w kJ·mol-1, 
R -- uniwersalna stała gazowa (8,314J·mol-1· K-1),
		

/p0124.djvu

			4. Wyniki 
__________________________________________________________________________ 
118 
a -- współczynnik kierunkowy prostej równania Arrheniusa, 
natomiast błąd przy pomocy wzoru: 
a 
aS 
R 
E× 
= 
Δ 
gdzie: 
ΔEa -- błąd energii aktywacji, 
Sa -- odchylenie standardowe współczynnika kierunkowego 
Wartości zebrano w tab. 47. 
Tab. 47. Zestawienie energii aktywacji dla rozkładu substratu -- chlorku związku X i tworzenia 
produktu -- związku WP 
Rodzaj wodorotlenku Energia aktywacji Ea 
dla chlorku związku X 
[kJ/mol] 
Energia aktywacji Ea 
dla związku WP 
[kJ/mol] 
NaOH 
42,30 ± 1,03 
36,34 ± 3,12 
KOH 
34,51 ± 3,47 
31,95 ± 3,57 
LiOH 
24,15 ± 4,42 
24,60 ± 5,29 
Znajomość stałych szybkości reakcji (k) w badanych temperaturach umożliwia 
obliczenie czasu t0,1 oraz t0,5 reakcji odpowiedniego rzędu. W tym przypadku reakcja 
rozkładu chlorku związku X jest procesem pierwszego rzędu i dlatego należy 
skorzystać ze wzoru: 
k 
t 1054 
, 
0 
1 
, 
0= 
Błąd wyliczono według wzoru: 
k 
k 
t 
Δ 
× 
= 
Δ 
2 
1 
, 
0 1054 
, 
0 
gdzie: 
Δt0,1 -- błąd czasu t0,1, 
Δk -- odchylenie standardowe stałej szybkości reakcji.
		

/p0125.djvu

			4. Wyniki 
__________________________________________________________________________ 
119 
Tab. 48. Zestawienie czasów t0,1 dla rozkładu chlorku związku X 
Czas t0,1 [h] rozkładu związku X przy użyciu zasady 
Temperatura 
[K] 
NaOH 
KOH 
LiOH 
313 
1,17 ± 0,08 
0,88 ± 0,13 
0,98 ± 0,12 
323 
0,68 ± 0,08 
0,59 ± 0,05 
0,88 ± 0,12 
333 
0,44 ± 0,03 
0,35 ± 0,05 
0,55 ± 0,03 
343 
0,28 ± 0,04 
0,29 ± 0,04 
0,46 ± 0,03 
Natomiast t0,5 obliczono korzystając z poniższej zależności: 
k 
t 693 
, 
0 
5 
, 
0= 
, 
błąd zaś wylicza się korzystając ze wzoru: 
k 
k 
t 
Δ 
× 
= 
Δ 
2 
5 
, 
0 693 
, 
0 
gdzie: 
Δt0,5 -- błąd czasu t0,5, 
Δk -- odchylenie standardowe stałej szybkości reakcji. 
Tab. 49. Zestawienie czasów t0,5 dla rozkładu chlorku związku X 
Czas t0,5 [h] rozkładu związku X przy użyciu zasady 
Temperatura 
[K] 
NaOH 
KOH 
LiOH 
313 
7,70 ± 0,56 
5,78 ± 0,87 
6,42 ± 0,82 
323 
4,44 ± 0,53 
3,85 ± 0,31 
5,78 ± 0,81 
333 
2,89 ± 0,22 
2,31 ± 0,32 
3,61 ± 0,23 
343 
1,83 ± 0,17 
1,89 ± 0,28 
3,04 ± 0,21
		

/p0126.djvu

			4. Wyniki 
__________________________________________________________________________ 
120 
4.4. Wyznaczanie wartości przemiany 50% chlorku związku 
X w sól wewnętrzną 2-(2-karboksy-4,5-dimetoksyfenylo)- 
6,7-dimetoksyizochinoliniową (pH50%) 
Wyniki przeprowadzonych pomiarów przedstawiono w tab. 50 a wykres 
przedstawiono na rys. 78. 
Absorbancję mierzono dla λ=256 nm dla przyrostu produktu oraz dla λ=310 
nm dla ubytku substratu. Zmiany w przebiegu widma w zależności od użytego 
roztworu NaOH przedstawiono na rys. 79. 
Tab. 50. Wyniki pomiarów 
Roztwór 
pH 
Absorbancja dla 
256 nm 
Absorbancja dla 
310 nm 
woda 
7,00 
0,2893 
0,5624 
0,001 M NaOH 
11,00 
0,3470 
0,3867 
0,0025 M NaOH 
11,40 
0,4536 
0,2670 
0,005 M NaOH 
11,70 
0,5949 
0,2255 
0,0075 M NaOH 
11,88 
0,6360 
0,1841 
0,01 M NaOH 
12,00 
0,6757 
0,1732 
0,025 M NaOH 
12,39 
0,8266 
0,1725 
0,05 M NaOH 
12,61 
0,8440 
0,1718 
0,1 M NaOH 
12,89 
0,8761 
0,1715 
Wyniki pomiarów podstawiono do poniższego równania: 
pH 
pH 
A 
A 
A 
A 
s 
s 
p 
p 
- 
= 
- 
- 
% 
50 
max 
max 
lg 
gdzie: 
Apmax- absorbancja próbki dodanej do 0,1M NaOH dla λ=256 nm 
Ap- absorbancja próbki badanej dla λ=256 nm 
Asmax- absorbancja próbki dodanej do wody dla λ=310 nm 
As -- absorbancja dla próbki badanej dla λ=310 nm
		

/p0127.djvu

			4. Wyniki 
__________________________________________________________________________ 
121 
-1,2 
-1 
-0,8 
-0,6 
-0,4 
-0,2 
0 
0,2 
0,4 
0,6 
0,8 
10,5 
11 
11,5 
12 
12,5 
13 
pH 
log(Apmax-Ap)/(Asmax-As)
Rys. 78. Wykres zależności log(Apmax-Ap/Asmax-As)=f(pH). 
Wykres przyjmuje postać: 
pH 
A 
A 
A 
A 
s 
s 
p 
p 
9864 
, 
0 
42 
, 
11 
lg max 
max 
- 
= 
- 
- 
Współczynnik korelacji wynosi r=0,9861. Na podstawie wykresu obliczono 
pH50% i wynosi ono 11,58. 
0,0 
0,1 
0,2 
0,3 
0,4 
0,5 
0,6 
0,7 
0,8 
0,9 
1,0 
225 245 260 280 300 320 340 360 380 400 420 440 460 480 500 
Długość fali [nm] 
Absorbancja
woda 
pH 11 (0,001 M NaOH) 
pH 11,4 (0,0025 M NaOH) 
pH 11,7 (0,005 M NaOH) 
pH 11,88 (0,0075 M NaOH) 
pH 12 (0,01 M NaOH) 
pH 12,39 (0,025 M NaOH) 
pH 12,61 (0,05 M NaOH) 
pH 13 (0,1 M NaOH) 
Rys. 79. Zmiany w przebiegu widma chlorku związku X podczas reakcji tworzenia związku 
WP
		

/p0128.djvu

			4. Wyniki 
__________________________________________________________________________ 
122 
4.5. Oznaczenie rozpuszczalności 
4.5.1. Oznaczenie rozpuszczalności soli 2,3,9,10-tetrametoksy-12- 
okso-12H-indolo[2,1-a]-izochinioliniowych 
4.5.1.1. Krzywa wzorcowa 
Krzywą wzorcową (A=f(c)) dla jodku brunatnego związku X otrzymano przez 
wykonanie 3 pomiarów dla każdego z 6 stężeń z zakresu 1,8530 - 18,5230 x 10-6 M. 
Powyższe stężenia odnoszą się do jonu 2,3,9,10-tetrametoksy-12-okso-12H- 
indolo[2,1-a]-izochinioliniowego, który jest wspólny dla trzech soli: jodku, chlorku oraz 
heksafluorofosforanu. Przy obliczaniu rozpuszczalności odpowiednio przeliczono 
stężenie jonu na ilość substancji rozpuszczonej dla każdej z wyżej wymienionych 
soli. Korzystając z metody najmniejszych kwadratów uzyskano prostą przechodzącą 
przez początek układu współrzędnych, która opisana jest przez następujące 
równanie liniowe: 
A=55164·c 
gdzie: 
c -- stężenie molowe roztworu związku X obliczone dla kationu X+ 
A -- absorbancja roztworu przy λ=310 nm 
Tab. 51. Zależność absorbancji od stężenia kationu związku X [ x 10-6 mol/] w roztworze dla 
trzech krzywych wzorcowych z uwzględnieniem przedziału ufności dla poziomu istotności α = 
0,05. 
Stężenie X 
[ x 10-6 mol/l] Wartość średnia 
±SD 
Przedział 
ufności dla 
α=0,05 
1,8530 
0,1013 ± 0,0025 ± 0,0062 
3,7060 
0,2154 ± 0,0027 ± 0,0068 
7,4120 
0,4069 ± 0,0107 ± 0,0265 
11,1180 0,6177 ± 0,0074 ± 0,0183 
14,8240 0,8074 ± 0,0146 ± 0,0363 
18,5230 1,0330 ± 0,0026 ± 0,0066
		

/p0129.djvu

			4. Wyniki 
__________________________________________________________________________ 
123 
Współczynnik korelacji liniowej wynosił r = 0,9997, co oznacza liniowy 
przebieg krzywej wzorcowej w zakresie badanych stężeń, z uwzględnieniem rozkładu 
normalnego. Wartość przesunięcia wykresu z OY ma wartość b = 0,0022, nie jest 
ona znacząca statystycznie i została pominięta. Wartości odchyleń standardowych 
dla poszczególnych stężeń mieszczą się w obliczonym przedziale ufności dla 
poziomu istotności α = 0,05. 
Wartości dla poszczególnych punktów krzywej wzorcowej są przedstawione w 
tab. 51. Wykres krzywej wzorcowej przedstawiono na rys. 80. 
Wartości precyzji dla oznaczeń intraday, wynoszą odpowiednio: 0,26% - 
2,62% a dla oznaczeń interday: 0,74%- 4,00%. Z kolei wartości parametru 
dokładności dla oznaczenia intraday dla powyższych stężeń wynoszą 99,07% - 
101,10%, a dla oznaczeń interday 92,9%-101,3%. Obliczone wartości LOD i LOQ dla 
brunatnego związku X wyniosły odpowiednio 7 x 10-7 mol/l i 14 x 10-7 mol/l. 
0,00 
0,20 
0,40 
0,60 
0,80 
1,00 
1,20 
0,0E+0 
0 2,0E-06 4,0E-06 6,0E-06 8,0E-06 1,0E-05 1,2E-05 1,4E-05 1,6E-05 1,8E-05 2,0E-05 
c[mol/l] 
Absorbancja
Rys. 80. Wykres krzywej wzorcowej dla kationu brunatnego związku X jako zależność 
absorbancji od jego stężenia
		

/p0130.djvu

			4. Wyniki 
__________________________________________________________________________ 
124 
4.5.1.2. Oznaczanie rozpuszczalności soli związku X 
Wyniki oznaczeń dla poszczególnych związków umieszczono w tab. 52-54. 
Tab. 52. Wyniki pomiarów dla heksafluorofosforanu X 
Numer próbki 
Oznaczenia absorbancji 
dla temperatury 25°C 
Oznaczenia absorbancji 
dla temperatury 37°C 
1 
0,8116 
0,5579 
2 
0,7262 
0,5855 
3 
0,7576 
0,5764 
4 
0,8297 
0,6125 
5 
0,8293 
0,6206 
6 
0,7926 
0,6245 
Średnia 
0,7912 
0,5962 
SD 
0,0417 
0,0270 
Rozpuszczalność heksafluorofosforanu związku X wynosi w temperaturze 
25°C 0,0713 g/l a w temperaturze 37°C wynosi 0,1075 g/l. 
Tab. 53. Wyniki pomiarów dla chlorku X 
Numer próbki 
Oznaczenia absorbancji 
dla temperatury 25°C 
Oznaczenia absorbancji 
dla temperatury 37°C 
1 
0,9208 
0,8961 
2 
0,9603 
1,016 
3 
0,9412 
1,013 
4 
0,9016 
0,9584 
5 
0,9576 
0,9647 
6 
0,8588 
0,9998 
Średnia 
0,9154 
0,9747 
SD 
0,0387 
0,0455 
Rozpuszczalność chlorku związku X wynosi w temperaturze 25°C 4,3343 g/l a 
w temperaturze 37°C 4,5762 g/l.
		

/p0131.djvu

			4. Wyniki 
__________________________________________________________________________ 
125 
Tab. 54. Wyniki pomiarów dla jodku X 
Numer próbki 
Oznaczenia absorbancji 
dla temperatury 25°C 
Oznaczenia absorbancji 
dla temperatury 37°C 
1 
0,5225 
0,5661 
2 
0,5046 
0,5964 
3 
0,5684 
0,5625 
4 
0,5325 
0,5885 
5 
0,5427 
0,5413 
6 
0,5059 
0,6775 
Średnia 
0,5094 
0,5887 
SD 
0,0242 
0,0477 
Rozpuszczalność jodku związku X wynosi w temperaturze 25°C 2,1049 g/l a w 
temperaturze 37°C 2,3579 g/l. 
4.5.2. Oznaczenie rozpuszczalności związku WP 
4.5.2.1. Krzywa wzorcowa 
Sporządzono krzywą wzorcową A=f(c) dla związku WP. Wykonano serię 
pomiarów dla stężeń z zakresu 1,6228 -- 15,9414 x 10-6 mol/l. Korzystając z metody 
najmniejszych kwadratów uzyskano prostą przechodzącą przez początek układu 
współrzędnych, która zgodnie z prawem Lamberta -- Beera, opisana jest przez 
następujące równanie liniowe: 
A=59297·c 
gdzie: 
c -- stężenie molowe roztworu związku WP 
A -- absorbancja roztworu
		

/p0132.djvu

			4. Wyniki 
__________________________________________________________________________ 
126 
Współczynnik korelacji liniowej wynosił r = 0,9999, co oznacza liniowy przebieg 
krzywej wzorcowej w zakresie badanych stężeń, z uwzględnieniem rozkładu 
normalnego. Wartość przesunięcia b = 0,0003 nie jest istotna statystycznie i została 
pominięta. Wartości odchyleń standardowych dla poszczególnych stężeń mieszczą 
się w obliczonym przedziale ufności dla poziomu istotności α = 0,05. 
Wartości dla poszczególnych punktów krzywej wzorcowej (rys. 81) są 
przedstawione w tab. 55. 
Tab. 55. Zależność absorbancji od stężenia WP [ x 10-6 mol/l ] w roztworze dla trzech 
krzywych wzorcowych z uwzględnieniem przedziału ufności dla poziomu istotności α = 0,05 
Stężenie WP [x106 M] 
Absorbancja 
Przedział ufności dla α = 0,05 
1,6628 
0,0925 ± 0,0053 
± 0,0133 
3,2391 
0,1965 ± 0,0075 
± 0,0186 
4,8490 
0,2868 ± 0,0061 
± 0,0151 
8,0496 
0,4823 ± 0,0085 
± 0,0212 
12,0149 
0,7075 ± 0,0092 
± 0,0228 
15,9414 
0,9471 ± 0,0049 
± 0,0123 
0,00 
0,10 
0,20 
0,30 
0,40 
0,50 
0,60 
0,70 
0,80 
0,90 
1,00 
0,0E+00 
5,0E-06 
1,0E-05 
1,5E-05 
2,0E-05 
c[mol/l] 
Absorbancja
Rys. 81. Wykres krzywej wzorcowej dla związku WP 
Wartości precyzji dla oznaczeń "intraday", wynoszą odpowiednio: 0,52%- 
5,77%, a dla oznaczeń "interday": 0,87% - 4,75%. Z kolei wartości parametru 
dokładności dla oznaczenia "intraday" dla powyższych stężeń wynoszą 96,12%- 
101,04%, a dla oznaczeń "interday" 98,27% - 101,25%.
		

/p0133.djvu

			4. Wyniki 
__________________________________________________________________________ 
127 
Obliczone wartości LOD i LOQ dla białego związku WP wyniosły odpowiednio 
3,6x10-7Mi7,1x10-7M. 
4.5.2.2. Wyniki oznaczenia rozpuszczalności 
Wyniki przedstawiono w tab. 56. 
Tab. 56. Wyniki pomiarów dla związku WP 
Numer próbki 
Oznaczenia absorbancji 
dla temperatury 25°C 
Oznaczenia absorbancji 
dla temperatury 37°C 
1 
0,5137 
0,7203 
2 
0,5160 
0,7311 
3 
0,5310 
0,7463 
4 
0,4888 
0,8058 
5 
0,4821 
0,8047 
6 
0,5081 
0,8180 
Średnia absorbancja 
0,5066 
0,7710 
SD 
0,0182 
0,0432 
Rozpuszczalność związku WP wynosi w temperaturze 25°C oraz w 37°C 
odpowiednio 0,3156 g/l i 0,4803 g/l. 
4.5.3. Oznaczenie rozpuszczalności związku NF 
4.5.3.1. Krzywa wzorcowa 
Sporządzono krzywą wzorcową A=f(c) dla następującego zakresu stężeń 
chlorku NF 2,5641 x 10-6 -- 3,0435 x 10-5 M. Korzystając z metody najmniejszych 
kwadratów obliczono parametry krzywej y=ax+b. Współczynnik kierunkowy wyniósł 
a=37645, wartość przecięcia b=-0,0226 a współczynnik korelacji r=0,9998. 
Zależność jest opisana przez poniższe równanie liniowe: 
A=38694c--0,0226 
gdzie:
		

/p0134.djvu

			4. Wyniki 
__________________________________________________________________________ 
128 
A -- absorbancja 
c- stężenie molowe roztworu związku NF 
Wyniki pomiarów przedstawiono w tab. 57, krzywą wzorcową przedstawia rys. 
82. 
Tab. 57. Wyniki oznaczeń dla krzywej wzorcowej dla związku NF 
Stężenie NF [10-6 M] Absorbancja ± SD Przedział ufności dla α 
= 0,05 
2,5641 
0,0802 ± 0,0060 
0,0149 
5,1232 
0,1783 ± 0,0030 
0,0074 
10,2260 
0,3715 ± 0,0073 
0,0181 
15,3083 
0,5580 ± 0,0168 
0,0417 
20,3706 
0,7599 ± 0,0081 
0,0202 
25,4129 
0,9595 ± 0,0242 
0,0601 
30,4352 
1,1610 ±0,0275 
0,0683 
0 
0,2 
0,4 
0,6 
0,8 
1 
1,2 
1,4 
0,00E+00 5,00E-06 1,00E-05 1,50E-05 2,00E-05 2,50E-05 3,00E-05 3,50E-05 
Absorbancja 
stężenie [M]
Rys. 82. Krzywa wzorcowa A=f(c) dla chlorku związku NF 
Wartości precyzji dla oznaczeń "intraday" wynoszą odpowiednio: 1,48% - 
5,83% i a dla oznaczeń "interday": 1,64%- 2,98%. Z kolei wartości parametru 
dokładności dla oznaczenia "intraday" dla powyższych stężeń wynoszą 91,65% - 
102,49%, a dla oznaczeń "interday" 91,91% - 99,32%.
		

/p0135.djvu

			4. Wyniki 
__________________________________________________________________________ 
129 
Obliczone wartości LOD i LOQ dla związku NF wyniosły odpowiednio 8,0116 x 
10-7 M i 1,6023 x 10-7 M. 
4.5.3.2. Wyniki oznaczenia rozpuszczalności 
Wyniki przedstawiono w tab. 58. 
Tab. 58. Wyniki pomiarów rozpuszczalności związku NF 
Numer próbki 
Oznaczenia absorbancji 
dla temperatury 25°C 
Oznaczenia absorbancji 
dla temperatury 37°C 
1 
0,6005 
0,7042 
2 
0,6133 
0,7031 
3 
0,5614 
0,6974 
4 
0,5732 
0,7205 
5 
0,5748 
0,6915 
6 
0,6080 
0,6988 
Średnia absorbancja 
0,5885 
0,7026 
SD 
0,0214 
0,0099 
Rozpuszczalność związku NF w temperaturze 25°C wynosi 1,6409 g/l a dla 
temperatury 37°C wynosi 1,9719 g/l.
		

/p0136.djvu

			4. Wyniki 
__________________________________________________________________________ 
130 
4.6. Wyznaczanie współczynnika lipofilowości dla 
związków X, WP oraz NF metodą chromatografii 
cienkowarstwowej 
Wyniki pomiarów współczynników Rf oraz Rm badanych substancji oraz 
substancji wzorcowych (W1-W6) przedstawiono w tab. 59 i 60 oraz na rys. 83- 91. 
Tab. 59. Wyniki pomiarów współczynników Rf dla badanych substancji oraz substancji 
wzorcowych. 
Rf 
zawartość 
modyfikatora 
polarności 
[%] Związek 
WP Związek 
X Związek 
NF 
W1W2W3W4W5W6 
45 
0,2893 0,0379 0,0253 0,5443 0,4241 0,2089 0,1646 0,1139 0,3899 
50 
0,3145 0,0503 0,0375 0,5912 0,4906 0,2641 0,2138 0,1635 0,4654 
55 
0,3585 0,0567 0,0382 0,6456 0,5283 0,2975 0,2531 0,2138 0,5189 
60 
0,3749 0,0937 0,0625 0,7088 0,5823 0,3354 0,3102 0,2548 0,6013 
65 
0,4063 0,1000 0,0688 0,7500 0,6500 0,4000 0,3813 0,3063 0,6375 
70 
0,4120 0,1465 0,1392 0,7436 0,6667 0,4553 0,4743 0,4267 0,7163 
75 
0,4177 0,153 0,1401 0,761 0,7342 0,5126 0,4841 0,4713 0,7307 
80 
0,4249 0,1635 0,1508 0,7848 0,7924 0,5722 0,6038 0,5408 0,7673 
Tab. 60. Wartości współczynnika Rm dla poszczególnych związków 
Rm 
zawartość 
modyfikatora 
polarności 
[%] Związek 
WP Związek 
X Związek 
NF 
W1W2W3W4W5W6 
45 
0,3903 1,4046 1,5857 -0,0772 0,1329 0,5783 0,7055 0,8909 0,1944 
50 
0,3384 1,276 1,4094 -0,1602 0,0163 0,445 0,5655 0,7089 0,0602 
55 
0,2527 1,2210 1,4010 -0,2605 -0,0492 0,3732 0,4699 0,5655 -0,0328 
60 
0,2230 0,9853 1,1761 -0,3863 -0,1443 0,297 0,3471 0,4661 -0,1784 
65 
0,1648 0,9542 1,1318 -0,4771 -0,2688 0,1761 0,2103 0,3551 -0,2451 
70 
0,1545 0,7653 0,7913 -0,4624 -0,3011 0,0773 0,0447 0,1282 -0,4019 
75 
0,1443 0,7442 0,7880 -0,503 -0,4412 -0,0219 0,0276 0,0499 -0,4335 
80 
0,1312 0,7089 0,7503 -0,562 -0,5817 -0,1263 -0,183 -0,0712 -0,5182
		

/p0137.djvu

			4. Wyniki 
__________________________________________________________________________ 
131 
Rys. 83. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla związku 
WP 
Rys. 84. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla związku 
X 
Rys. 85. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla związku 
NF
		

/p0138.djvu

			4. Wyniki 
__________________________________________________________________________ 
132 
Rys. 86. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla izatyny 
(W1) 
Rys. 87. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla N-(2,6- 
dichlorofenylo)acetamidu (W2) 
Rys. 88. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla N-(2,4- 
dichlorofenylo)acetamidu (W3)
		

/p0139.djvu

			4. Wyniki 
__________________________________________________________________________ 
133 
Rys. 89. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla 3,4- 
dichloroaniliny (W4) 
Rys. 90. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla 2,6- 
dichloroaniliny (W5) 
Rys. 91. Zależność wartości Rm jako funkcji zawartości modyfikatora polarności dla p- 
nitrofenolu (W6)
		

/p0140.djvu

			4. Wyniki 
__________________________________________________________________________ 
134 
Wartość przecięcia z osią rzędnych stanowi ekstrapolowaną wartość Rmw, 
czyli taką wartość współczynnika Rm, gdyby chromatogram rozwijano w czystej 
wodzie. Wartości Rmw substancji wzorcowych zestawiono ze współczynnikiem logP 
(tab. 61) i wykreślono wykres funkcji prostoliniowej Rmw=f (logP) (rys. 92). 
Tab. 61. Zestawienie wartości logP [92] z Rmw. 
substancja 
wzorcowa 
LogP 
Rmw 
W1 
0,83 
0,5026 
W2 
1,32 
1,0111 
W3 
2,18 
1,4653 
W4 
2,69 
1,8411 
W5 
2,82 
2,0909 
W6 
1,38 
1,0899 
Rys. 92. Wykres zależności Rmw=f(logP) 
Na podstawie parametrów prostej obliczone zostały współczynniki lipofilowości 
(logP) dla badanych związków i wyniosły one odpowiednio: dla związku WP 0,97, dla 
chlorku związku X 3,28 oraz dla chlorku związku NF 3,85.
		

/p0141.djvu

			4. Wyniki 
__________________________________________________________________________ 
135 
4.7. Wyznaczenie cytotoksyczności -- test IC50 
Oznaczenia zostały wykonane we współpracy z Katedrą i Zakładem Chemii 
Klinicznej Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu. 
4.7.1. Chlorek NF 
Chlorek związku NF zbadano pod kątem aktywności cytotoksycznej na 
komórkach raka sutka MCF-7. Wyniki umieszczono w tab. 61 i na rys. 87. IC50 
badanego związku wynosi 1,2148 μM. 
Tab. 62. Wyniki oznaczenia cytotoksyczności dla chlorku związku NF 
Stężenie [μM] Absorbancja 
próby 
SD 
Aktywność 
komórek 
względem 
próby 
kontrolnej 
[%] 
0,00064 
0,5055 
0,0032 
95,38 
0,0032 
0,4818 
0,0660 
90,9 
0,016 
0,4305 
0,0128 
81,23 
0,08 
0,4098 
0,0058 
77,31 
0,4 
0,3125 
0,0112 
58,96 
2 
0,2238 
0,0027 
42,22 
10 
0,1735 
0,0038 
32,74 
20 
0,1370 
0,0052 
28,85 
Absorbancja próby 
kontrolnej 
0,5300 
0,0164
		

/p0142.djvu

			4. Wyniki 
__________________________________________________________________________ 
136 
0 
20 
40 
60 
80 
100 
120 
0,00064 0,0032 0,016 
0,08 
0,4 
2 
10 
20 
Stężenie [μM] 
Aktyność komórek [%]
Rys. 93. Wykres przedstawiający zmianę aktywnośći komórek MCF-7 w zależności od 
stężenia chlorku NF 
4.7.2. Jodek X 
Wyniki oznaczenia cytotoksyczności przedstawiono w tab. 63 oraz na rys. 94. 
Wartość IC50 badanego związku wynosi 0,4142 μM. 
Tab. 63. Wyniki oznaczenia cytotoksyczności dla jodku związku X 
Stężenie [μM] 
Absorbancja 
próby 
SD 
Aktywność 
komórek 
względem próby 
kontrolnej [%] 
0,00064 
0,5468 
0,0102 
103,16 
0,0032 
0,5685 
0,0094 
107,26 
0,016 
0,5513 
0,0058 
104,01 
0,08 
0,4490 
0,0188 
84,72 
0,4 
0,2140 
0,0148 
40,37 
2 
0,0885 
0,0036 
16,70 
10 
0,0535 
0,0020 
10,09 
20 
0,0580 
0,0004 
10,94 
Absorbancja próby 
kontrolnej 
0,5300 
0,0164
		

/p0143.djvu

			4. Wyniki 
__________________________________________________________________________ 
137 
0 
20 
40 
60 
80 
100 
120 
0,00064 0,0032 0,016 0,08 
0,4 
2 
10 
20 
Stężenie [μM] 
Aktywność komórek [%]
Rys. 94. Wykres przedstawiający zmianę aktywnośći komórek MCF-7 w zależności od 
stężenia jodku związku X 
4.7.3. Związek WP 
Wartość IC50 związku WP wynosi 14,98 mM. Wyniki oznaczeń zostały 
przedstawione w tab. 64 oraz na rys. 95. 
Tab. 64. Oznaczenie cyttoksyczności związku WP 
Stężenie [μM] Absorbancja 
próby 
SD 
Aktywność 
komórek 
względem 
próby 
kontrolnej [%] 
0,1 
1,1533 
0,0179 
93,14 
0,5 
1,2028 
0,0539 
97,14 
1 
1,1798 
0,0202 
95,28 
5 
1,1483 
0,0231 
92,74 
10 
1,1393 
0,0295 
92,01 
25 
1,1123 
0,0202 
89,83 
50 
1,0699 
0,0184 
86,41 
100 
1,0365 
0,0141 
83,71 
Absorbancja próby 
kontrolnej 
1,2382 
0,0636
		

/p0144.djvu

			4. Wyniki 
__________________________________________________________________________ 
138 
0 
20 
40 
60 
80 
100 
120 
0,1 
0,5 
1 
5 
10 
25 
50 
100 
Stężenie [μM] 
Aktywność komórek [%]
Rys. 95. Wykres przedstawiający zmianę aktywnośći komórek MCF-7 w zależności od 
stężenia związku WP
		

/p0145.djvu

			4. Wyniki 
__________________________________________________________________________ 
139 
4.8. Oznaczanie hamowania aktywności telomerazy i 
polimerazy 
Oznaczenia zostały wykonane we współpracy z Katedrą i Zakładem Chemii 
Klinicznej Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu. 
Zmierzono aktywność w kierunku hamowania telomerazy oraz polimerazy Taq 
dla związku X oraz związku NF. Wyniki zestawiono w tab. 65 i przedstawiono na rys. 
96i97. 
Tab. 65. Oznaczenia aktywności badanych związków w kierunku hamowania telomerazy 
oraz polimerazy 
Związek NF 
Związek X 
Stężenie[μM] Telomeraza Polimeraza Telomeraza Polimeraza 
próba kontrolna 
0,290 
0,379 
0,290 
0,379 
0,001 
0,263 
0,35 
0,263 
0,372 
0,005 
0,274 
0,428 
0,249 
0,35 
0,01 
0,287 
0,369 
0,291 
0,371 
0,05 
0,223 
0,301 
0,289 
0,33 
0,1 
0,238 
0,307 
0,292 
0,437 
0,5 
0,352 
0,171 
0,340 
0,235 
1 
0,275 
0,127 
0,304 
0,213 
5 
0,034 
0,04 
0,279 
0,098 
10 
0,035 
0,034 
0,091 
0,052
		

/p0146.djvu

			4. Wyniki 
__________________________________________________________________________ 
140 
Związek NF 
0 
0,1 
0,2 
0,3 
0,4 
0,5 
K 0,001 0,005 0,01 0,05 0,1 0,5 1 5 10 
Stężenie[μM] 
Absorbancja
Telomeraza 
Polimeraza 
Rys. 96. Zależność hamowania aktywności telomerazy i polimerazy dla związku NF 
Związek X 
0 
0,1 
0,2 
0,3 
0,4 
0,5 
K 0,001 0,005 0,01 0,05 0,1 0,5 1 5 10 
Stężenie[μM] 
Absorbancja
Telomeraza 
Polimeraza 
Rys. 97. Zależność hamowania aktywności telomerazy i polimerazy dla związku X
		

/p0147.djvu

			4. Wyniki 
__________________________________________________________________________ 
141 
4.9. Oznaczenie powinowactwa do DNA 
Oznaczenia wiązania z DNA metodą dializy równowagowej zostały wykonane 
we współpracy z Zakładem Chemii Analitycznej Uniwersytetu im. Adama Mickiewicza 
w Poznaniu. 
Tab. 66. Wyniki oznaczeń wiązania z DNA 
Tab. 67. Sekwencje poszczególnych primerów 
Numer primeru 
Sekwencja 
primer 1 
d(CAATCGGATCGAATTCGATCCGATTG) 
primer 2 
d(GAAAGAGAGGAGG) 
primer 3 
d(CTCCTCTCTTTCCCTTCTTTCTCTCCTCC) 
primer 4 
d(GAGGGTGGGGAGGGTGGGGAA) 
primer 5 
d(AGGGTTAGGGTTAGGGTTAGGG) 
primer 6 
d(TTGGGGGGGGGGGGGGGGGGGGTT) 
primer 7 
d(GAGAGAGAGAGAGAGAGAGAGAGA) 
Stężenie związanego związku [μM] 
DNA 
Związek NF 
Związek X Związek WP 
A1- poly dA (ss) 
0,023 
0,485 
0 
B1- poly rA (ss) 
0,039 
1,645 
1,137 
C1- poly rU (ss) 
0 
1,316 
1,127 
D1- poly dA·poly dT (ds) 
2,213 
8,948 
1,487 
E1- poly dG·poly dC (ds) 
0,877 
2,130 
0,737 
A3- poly (dA-dT)2 (ds) 
0,272 
1,616 
2,426 
B3- poly (dG-dC)2 (ds) 
0,334 
3,995 
0,448 
C3-26mer (primer 1) (ds) 
1,607 
3,169 
0,457 
D3-24mer GA (primer 7) (ds) 
0,769 
4,243 
0,477 
E3-polydT·polydA·polydT 
3,238 
14,779 
4,045 
A5- primer 2 + primer 3 
1,328 
6,858 
0,208 
B5-21mer c-MYC (primer 4) 
2,757 
12,579 
3,175 
C5-22mer AG (primer 5) 
3,160 
8,065 
3,185 
D5-24mer G20 (primer 6) 
2,135 
8,833 
0,318
		

/p0148.djvu

			4. Wyniki 
__________________________________________________________________________ 
142 
0,0 
2,0 
4,0 
6,0 
8,0 
10,0 
12,0 
14,0 
16,0 
A1B1C1D1E1A3B3C3D3E3A5B5C5D5 
Związek 
Stężenie [μM]
Związek NF 
Związek X 
Związek WP 
Rys. 98. Stężenia ligandów związanych z DNA
		

/p0149.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
143 
5. Omówienie i dyskusja wyników 
Głównym celem projektu było rozwiązanie struktury nowej pochodnej 
izochinolinowej powstałej z brunatnego związku X. Związek X został opisany w 
literaturze po raz pierwszy pod koniec lat pięćdziesiątych XX wieku [2]. Kilka lat 
później wyizolowano go metodą chromatografii cienkowarstwowej [93]. Ostatecznie 
jego struktura została opisana kilka lat temu. Wtedy też po raz pierwszy pojawiła się 
wzmianka o związku WP [4]. 
Widmo UV-Vis związku X wykonane w metanolu charakteryzuje się dwoma 
maksimami absorpcji przy 310 nm oraz przy 398 nm (rys. 12). Brązowy roztwór 
związku X odbarwia się pod wpływem wodnego roztworu NaOH. Powoduje to zmiany 
w przebiegu widma. Maksima absorpcji dla związku X (λmax=310 nm, lgε=4,74 oraz 
λmax=398 nm, lgε=4,10) ulegają przesunięciu hipsochromowemu do λmax=256 nm, 
lgε=4,77 oraz λmax=322 nm, lgε=4,17 (tab. 8, rys. 23). 
W widmie IR związku WP pojawiły się charakterystyczne pasma rozciągające 
przy 1599 cm-1 (asymetryczne) oraz 1398 cm-1 (symetryczne) będące 
charakterystyczne dla drgań grupy --COO- (tab. 9, rys. 24) [50]. Podobne pasma 
zaobserwowane zostały przez Kinoshitę i wsp. w grupie zwiazków nazywanych 
panaefluorolinami A-C, wyizolowanymi z porostów Amygdalia panaeola. Są to 
pochodne izochinoliny o charakterze jonów obojnaczych. Zawierają w swojej 
budowie dodatnio naładowany atom azotu oraz grupę --COO- 
. Sygnały dla ujemnie 
naładowanego węgla karboksylowego występują w zakresie 1625-1635 cm-1 w 
powyższych związkach [60]. Z kolei Kochkar i wsp. zaobserwowali na widmie IR 
utlenionej skrobi przemytej wodą pik przy 1650 cm-1. Odpowiada on zjonizowanej 
grupie karboksylowej [94]. Charakterystyczne piki dla grupy --COO- zaobserwowano 
również w pochodnych karboksylowych cynku. Tutaj oprócz pików dla liczby falowej 
około 1600 cm-1, zaobserwowane zostały również pasma rozciągające symetryczne 
o liczbach falowych w przedziale (1418-1343 cm-1) [95]. 
O obecności układu izochinoliniowego świadczy obecność pasma przy 1490 
cm-1. Na widmie zaobserwować można pasma pochodzące od wody pozostałej po 
procesie suszenia. Są to piki leżące przy 3397 cm-1 oraz 3603 cm-1, z czego to 
ostatnie należy do drgań rozciągających wiązania wodorowego [96, 97]. Pozostałe 
widoczne pasma potwierdzają charakter aromatyczny związku. Są to piki o liczbie 
falowej 3031 cm-1, 3020 cm-1 opisujące drgania rozciągające typu Ar-H. Drgania
		

/p0150.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
144 
deformacyjne tej grupy są opisane przez piki przy 897 cm-1 oraz 886 cm-1. Drgania 
wiązań podwójnych C=C są potwierdzone przez piki o liczbie falowej 1632 cm-1, 1608 
cm-1 oraz 1518 cm-1. Przy 1773 cm-1 występują drgania deformacyjne pierścienia 
fenylowego. Drgania wiązań alifatycznych --C-H występują przy 2839 cm-1, 1466 cm-1 i 
1455 cm-1. Z kolei dragania typu CAr-O, pochodzące z grup metoksylowych, występują 
przy 1199 cm-1 [50, 53, 98]. 
W analizie strukturalnej wykorzystano również spektroskopię NMR. Obok 
klasycznych widm jednowymiarowych zarejestrowano również widma dwuwymiarowe 
obejmujące oddziaływania pomiędzy tymi samymi atomami (COSY LR oraz NOESY) 
oraz pomiędzy różnymi atomami (HSQC i HMBC). Techniki te są rutynowo 
stosowane w analizie strukturalnej [99]. 
Widmo 1H NMR związku X zostało zarejestrowane w kwasie trifluorooctowym 
(rys. 14 i tab. 3). Wykazało ono obecność 6 protonów aromatycznych oraz 12 
protonów grup metoksylowych. Natomiast widmo 13C CP NMR wykazało obecność 
20 atomów węgla, z czego 4 pochodzą z grup metoksylowych, a 16 z układu 
tetracyklicznego (rys. 15-16 i tab. 4). Widmo 15N NMR wykazało obecność jednego 
dodatnio naładowanego atomu azotu (rys. 17). Przesunięcia chemiczne [ppm] 
zostały przyporządkowane w następujący sposób: 
1H NMR (300 MHz, TFA) 8,50 (H-1, singlet); 7,44 (H-4, singlet); 8,25 (H-5, singlet); 
8,76 (H-6, dublet); 7,58 (H-8, dublet); 7,51 (H-11, singlet); 4,166 (2-OCH3, singlet); 
4,164 (3-OCH3, singlet); 4,11 (9-OCH3, singlet); 4,03 (10-OCH3, singlet). 
13C CP NMR (75 MHz, TFA) 105,9 (C-1); 160,9 (C-2); 164,0 (C-3); 109,7 (C-4); 146,5 
(C-4a); 129,7 (C-5); 129,0 (C-6); 146,9 (C-7a); 101,9 (C-8); 161,4 (C-9); 155,1 (C- 
10); 111,9 (C-11); 119,4 (C-11a); 186,7 (C-12); 136,5 (C-12a); 127,0 (C-12b); 60,06 
(2-OCH3); 60,26 (3-OCH3); 60,33 (9-OCH3); 59,81 (10-OCH3). 
15N NMR (30 MHz, TFA, nitrometan) -177,2 (skala nitrometanu). 
N 
O 
H3CO 
H3CO 
OCH3 
OCH3 
Cl-
		

/p0151.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
145 
Rys. 99. Wzór strukturalny chlorku 2,3,9,10-tetrametoksy-12-okso-12H-indolo[2,1- 
a]izochinoliniowego (związek X). 
Widmo 13C DEPT NMR związku X (rys. 18) wykazało, że bezpośrednio z 
atomami wodoru związane są następujące atomy węgla: C-1, C-4, C-5, C-6, C-8 oraz 
C-11. Protony grup metoksylowych to 2-OCH3, 3-OCH3, 9-OCH3 i 10-OCH3. 
Widmo 1H NMR związku WP zostało wykonane w deuterowanym metanolu 
oraz DMSO celem wyeliminowania mobilnych protonów grupy hydroksylowej (rys. 
28-33, tab. 12). Przesunięcia chemiczne [ppm] przyporządkowano w następujący 
sposób: 
1H NMR (300 MHz, DMSO-d6, TMS) 9,55 (H-1, dublet); 8,41 (H-3, podwójny dublet); 
8,39 (H-4, podwójny dublet); 7,75 (H-5, singlet); 7,57 (H-8 i H-3', singlet, sygnały się 
nakładają); 7,21 (H-6', singlet); 4,07 (6-OCH3, singlet); 3,94 (7-OCH3, singlet); 3,85 
(4'-OCH3, singlet); 3,81 (5'-OCH3, singlet). 
1H NMR (300 MHz, metanol-d4, TMS) 9,47 (H-1, dublet); 8,34 (H-3, podwójny 
dublet); 8,16 (H-4, dublet); 7,64 (H-5, singlet); 7,57 (H-8); 7,58 (H-3', singlet); 7,15 
(H-6', singlet); 4,13 (6-OCH3, singlet); 3,98 (7-OCH3, singlet); 3,96 (4'-OCH3, singlet); 
3,90 (5'-OCH3, singlet). 
Widmo 13C CP NMR (rys. 34 - 35, tab. 13) zostało zarejestrowane w 
deuterowanym metanolu i przesunięcia chemiczne przyporządkowano do 
następujących atomów węgla: 
13C NMR (75 MHz, metanol-d4, TMS) 147,5 (C-1); 136,27 (C-3); 123,13 (C-4); 137,33 
(C-4a); 106,38 (C-5); 159,97 (C-6); 154,35 (C-7); 108,29 (C-8); 125,09 (C-8a); 
136,15 (C-1'); 128,24 (C-2'); 114,35 (C-3'); 151,32 (C-4'); 151,49 (C-5'); 110,74 (C- 
6'); 57,52 (6-OCH3); 57,00 (7-OCH3); 56,54 (4'-OCH3); 56,95 (5'-OCH3); 170,29 (2'- 
COO-). 
15N NMR (30 MHz, DMSO-d6, nitrometan) -181,9 (skala nitrometanu). 
Analiza porównawcza widm 1H NMR wykonanych w deuterowanym metanolu 
oraz DMSO wykazała obecność 7 aromatycznych protonów i 12 protonów grup 
metoksylowych. 
Podobne przesunięcia chemiczne atomów wodoru i węgla dla grup 
metoksylowych jak w związku WP i związku X stwierdzono w alkaloidach 
berberynowych takich jak: berberyna [100], palmatyna [101], pseudopalmatyna [102, 
103], kolumbamina [104, 105], dehydrokorydalina [106], talifendyna [107], jatroryzyna 
[105, 108].
		

/p0152.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
146 
Widmo 13C DEPT NMR (rys. 36, tab. 14) wykazało, że z atomy wodoru 
bezpośrednio związane są z atomami węgla o następujących przesunięciach 
chemicznych 147,5, 136,27, 123,13, 114,35, 110,74, 106,29, 106,38 (wiązania C-H 
pierścieni aromatycznych) oraz 57,52, 57,00, 56,95 i 56,94 (grupy --CH3 w 
podstawnikach metoksylowych). W porównaniu z widmem 13C DEPT związku X (rys. 
18) można zaobserwować obecność 6 protonów w wiązaniach --C-H. Świadczy to o 
tym, że dodatkowy sygnał nie pochodzi od protonu grupy hydroksylowej. Potwierdza 
to dodatkowo pomiar wykonany w deuterowanym metanolu. Nie obserwuje się 
zmiany liczby protonów w porównaniu z widmem 1H NMR wykonanym w 
deuterowanym DMSO. Przyporządkowanie konkretnych protonów do atomu węgla 
umożliwia widmo 1H, 13C HSQC NMR (rys. 46 - 47 i tab. 17). Są to następujące 
korelacje dla pierścienia izochinoliniowego związku WP 1H: δ 9,47- 13C: δ 147,5; 1H: 
δ 8,34- 13C δ 136,27; 1H: δ 8,16- 13C δ 123,13; 1H: δ 7,64- 13C: δ 106,38; 1H: δ 7,57- 
13C δ 108,29 oraz dla pierścienia fenylowego: 1H: δ 7,58- 13C δ 114,35 i 1H: δ 7,15- 
13C δ 110,74. Dla grup metoksylowych zaobserwowano następujące korelacje: 1H: δ 
4,13- 13C δ 57,52; 1H: δ 3,98- 13C δ 57,00; 1H: δ 3,96- 13C δ 56,54; 1H: δ 3,90- 13C δ 
56,95. W porównaniu z widmem 1H, 13C HSQC NMR związku X (rys. 22, tab. 7) 
zaobserwowano, oprócz czterech sprzężeń dla grup metoksylowych, sześć protonów 
związanych bezpośrednio z atomami węgla. Są to 1H: δ 8,50- 13C δ 105,9; 1H: δ 
7,44- 13C δ 109,7; 1H: δ 8,25- 13C δ 129,7; 1H: δ 8,76- 13C: δ 129,0; 1H: δ 7,58- 13C δ 
101,9; 1H: δ 7,51- 13C δ 111,9. Dodatkowy proton został przyłączony do węgla o 
przesunięciu chemicznym 147,5 ppm w pierścieniu izochinoliny. Podobne 
przesunięcia chemiczne można zaobserwować w atomach węgla sąsiadujących z 
dodatnio naładowanym azotem w panaefluorolinach A-C. Ich przesunięcia 
chemiczne wynoszą 144,4 -- 147,8 ppm. 
Umiejscowienie dodatkowego protonu potwierdziło również widmo 1H, 1H 
NOESY NMR opisujące oddziaływania przestrzenne pomiędzy atomami wodoru (rys. 
48 -- 49, tab. 18). Proton o przesunięciu chemicznym 9,47 wykazuje korelację 
przestrzenną z protonami H-8 oraz H-6'. 
Na widmie 1H, 15N HMBC związku X (rys. 21) zaobserwowano korelację atomu 
azotu z protonami H-5, H-6 układu izochinolinowego oraz H-8 i H-11 (słaba) 
pierścienia fenylowego. Natomiast powyższa korelacja dla związku WP (rys. 45) 
wykazała obecność pięciu sprzężeń. Są to następujące protony H-1, H-3 oraz H-4 
układu izochinolinowego oraz H-3' i H-6' pierścienia fenylowego.
		

/p0153.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
147 
Oddziaływania przez wiązania 1H, 1H COSY LR ze względu na nieobecność 
protonu w pozycji 12b w związku X (pozycja analogiczna do pozycji 1 w związku WP) 
nie wykazały sygnału korelacji z protonami H-1, H-4, H-5 oraz H-6 (rys. 19 i tab. 5). Z 
kolei w przypadku związku WP proton w pozycji 1 wykazuje oddziaływanie z 
protonami H-3, H-4 (słabe) oraz H-5 układu izochinolinowego (rys. 38-40, tab. 15). 
Z widma 1H, 13C HMBC NMR dla związku WP wynika, że istnieje korelacja 
węgla grupy karboksylowej (2'-COO-) z protonami C-3' i C-6' pierścienia fenylowego 
(rys. 41-42 oraz 44, tab. 16). W związku X można zaobserwować korelację 1H, 13C 
HMBC NMR atomu węgla grupy karbonylowej z atomami wodoru H-11 i H-8 (słaba) 
pierścienia fenylowego (rys. 20, tab. 6). 
Ujemnie naładowana grupa karboksylowa znajduje się przy δ 170,29 ppm na 
widmie 13C NMR. Według danych literaturowych [109] węgiel grupy --COO- występuje 
przy δ 169,8 dla retikulatyny oraz przy δ 164,1 dla 14-bromoretikulatyny. Z kolei w 
grupie panaeflourolin A-C na widmie 13C NMR zaobserwowano sygnały dla grup 
karboksylowych przy δ 170,5 oraz δ 173,1 [60]. Barczyński i wsp. również 
zaobserwowali na widmach 13C NMR pochodnej pirydyniowej o charakterze soli 
wewnętrznej sygnał dla zjonizowanej grupy karboksylowej o przesunięciu 
chemicznym 171 ppm oraz 173 ppm [110]. 
Widmo 1H, 13C HMBC nie pokazuje korelacji pomiędzy protonem H-3 a 
węglem grupy --COO- 
. Protony H-3' oraz H-6' wykazują korelację z grupą 
karboksylową. Dodatkowe korelacje są uwidocznione na rys. 41 i 43 oraz w tabeli 16. 
W przypadku związku X węgiel grupy karbonylowej wykazuje korelację z protonem 
H-1 i H-11. 
Widmo NOESY NMR udowodniło, że wodór o δ 9,47 należy do pierścienia 
izochinolinowego. Na widmie stwierdzono sygnały korelacyjne z protonami H-1 oraz 
H-8 (rys. 48, tab. 18). Ponadto zostało to również udowodnione na widmach COSY 
LR NMR. Występuje korelacja z protonami H-1 z H-3, H-4 i H-5 (rys. 38-39, tab. 15). 
Przesunięcie chemiczne azotu w widmie 15N NMR wynosi -181,9 ppm (skala 
nitrometanu). Świadczy to o obecności dodatniego ładunku na atomie azotu [66, 99]. 
Dwuwymiarowe widmo 1H, 15N HMBC NMR związku WP (rys. 45) zarejestrowane w 
DMSO-d6 pokazało korelację z następującymi sygnałami: δ 8,34 (H-3), δ 8,16 (H-4), 
δ 7,15 (H-6'), δ 7,58 (H-3') oraz δ 9,47 (H-1). W porównaniu z widmem 1H, 15N 
HMBC związku X (rys. 21) zaobserwowano korelację z protonami pierścienia
		

/p0154.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
148 
benzenowego (H-5: 8,25; H-6: 8,76) i izochinoliny (H-8: 7,58; H-11: 7,51). To 
potwierdza, że pierścień fenylowy jest przyłączony do dodatnio naładowanego azotu. 
Proton δ 9,47 jest przesunięty w kierunku niższego pola ze względu na 
obecność dodatnio naładowanego azotu [50, 53]. Podobne przesunięcie chemiczne 
wykazuje proton w retikulatynie (δ 9,21) oraz w 14-bromoretikulatynie [109]. 
Podobnym przesunięciem chemicznym charakteryzują się protony sąsiadujące z 
dodatnio naładowanym atomem azotu w panaefluorolinach A-C [60] oraz w 
czwartorzędowych alkaloidach berberynowych [100, 101, 102, 103, 104, 106, 107, 
108, 111, 112]. Te protony są w pozycji orto- w odniesieniu do atomu azotu. 
Na podstawie powyższych rozważań przypisano związkowi WP strukturę soli 
wewnętrznej 2-(2-karboksy-4,5-dimetoksyfenylo)-6,7-dimetoksyozochinoliniowej. Jej 
wzór jest przedstawiony na rys. 100. Struktura ta jest przedmiotem zastrzeżenia 
patentowego [113]. 
N 
MeO 
MeO 
OMe 
OMe 
1 
3 
4 
5 
6 
78 
4a 
8a 
1' 
2' 
3' 4' 
5' 
6' 
O 
O 
Rys. 100. Wzór strukturalny soli wewnętrznej 2-(2-karboksy-4,5-dimetoksyfenyl)-6,7- 
dimetoksyozochinoliniowej (związek WP). 
Nowy związek ma strukturę jonu obojnaczego (tzw. zwitterionu). Stabilne jony 
obojnacze tworzą pochodne 2,4,6- trifenylopirydynowe [114]. Furosemid jest lekiem, 
który może być utleniany do zwitterionów. Produktem utleniania jest benzoesan 4- 
chloro-2-(3-hydroksypirydyniio-1-ylo)-5-sulfamylowy, który ma również strukturę soli 
wewnętrznej. Te związki mają podobny fragment struktury do związku WP. Jest to 
dodatnio naładowany atom azotu i ujemnie naładowana grupa --COO- w pozycji orto- 
do węgla przyłączonego atomu azotu układu heterocyklicznego. Walterová i wsp. 
[115] dowiedli, że pochodne papaweryny istnieją w roztworach alkalicznych jako
		

/p0155.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
149 
pseudozasady. Grupa --OH przyłączała się do pierścienia izochinolinowego w pozycji 
1. Zostało to udowodnione badaniami 1H NMR. Natomiast Fretz i wsp. [116] 
wykazali, że faskaplysina pod wpływem roztworu zawierającego jony --OH- zmienia 
swoją barwę i tworzy się retikulatyna o strukturze jonu obojnaczego. Obserwacje 
poczynione przez Fretza i wsp. potwierdzają nasze badania, w których 
czteropierścieniowa struktura związku X jest zmieniona w strukturę soli wewnętrznej. 
Schemat tworzenia związku WP jest przedstawiony na rys. 101. 
N 
MeO 
MeO 
OMe 
OMe 
O 
N 
MeO 
MeO 
OMe 
OMe 
HO 
O 
N 
MeO 
MeO 
OMe 
OMe 
HO 
O 
N 
MeO 
MeO 
OMe 
OMe 
O 
O 
1 
2 
1 
3 
4 
5 
6 
78 
4a 
8a 
1' 
2' 
3' 4' 
5' 
6' 
OH 
Rys. 101.Schemat tworzenia się nowego związku WP 
Proces tworzenia nowego związku polega na substytucji nukleofilowej grupy 
wodorotlenowej do atomu węgla grupy karbonylowej brunatnego związku X (1) [117]. 
Po przyłączeniu grupy --OH dochodzi do heterolitycznego rozpadu wiązania C1-C12. 
Na węglu C-1 układu izochinoliny umiejscawia się ładunek ujemny [51]. Na skutek 
przegrupowania proton utworzonej grupy --COOH dysocjuje i ulega przyłączeniu do 
ujemnie naładowanego węgla C1 izochinoliny z utworzeniem jonu obojnaczego tj. 
związku WP (2). 
Na widmie ESI-MS substratu występuje pik o m/z 352 (rys. 13). Natomiast na 
widmie ESI-MS wykonanym dla produktu występuje pik jonu pseudomolekularnego
		

/p0156.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
150 
[M+H+] dla m/z 370 (rys. 25). Wzór sumaryczny C20H19NO6 został oparty na analizie 
HREI-MS dla jonu molekularnego [M+] dla m/z 369,12205 (369,12124; Δ -2,2 ppm). 
Analiza elementarna potwierdziła pomiary HREI-MS (tab. 10). Masa molowa związku 
WP jest potwierdzona przez "regułę azotową", która mówi że związki posiadające 
nieparzystą liczbę atomów azotu charakteryzują się nieparzystą masą cząsteczkową 
[53]. 
W widmie EI-MS widać szereg pików fragmentacyjnych (rys. 26, tab. 11). 
Jonem podstawowym i zarazem jonem molekularnym jest jon o m/z 369 (jon a). 
Podstawową cechą rozpadu masowego zwiazku WP jest zrywanie wiązań Csp2-Csp2 i 
Csp2-O w podstawniku karboksylowym w szkielecie N-(dimetoksykarboksyfenylo)- 
dimetotksyizochinolinowym. Równoczesny rozpad wiązań Csp2-H i Csp2-Csp2 w jonie 
molekularnym a, któremu towarzyszy migracja atomu wodoru i eliminacja rodnika 
˙COOH prowadzi do czteropierścieniowego parzystoelektronowego jonu 
fragmentacyjnego e. Posiada on ładunek dodatni na atomie azotu w pierścieniu 
izochinolinowym. W procesie fragmentacji EI-MS jonu molekularnego związku WP 
rozpad wiązań Csp2-O w podstawniku karboksylowym oraz Csp2-H w szkielecie 
izochinolinowym poprzedza zmianę struktury jonu wynikającą z migracji atomu 
wodoru do atomu tlenu i eliminacji rodnika ˙OH. W ten sposób powstaje jon 
fragmentacyjny c. 
Wyrzut neutralnej cząsteczki tlenku węgla z jonu fragmentacyjnego c prowadzi 
do powstania parzystoelektronowego jonu fragmentacyjnego e. Należy również 
zaznaczyć, że wyrzut rodnika ˙H z jonu molekularnego a prowadzi do 
czteropierścieniowego parzystoelektronowego jonu fragmentacyjnego b. Wyrzut 
obojętnej cząstki tlenku węgla z jonu b prowadzi do powstania 
parzystoelektronowego jonu fragmentacyjnego d. 
Następne kroki we fragmentacji EI-MS jonu molekularnego obejmują rozpad 
wiązań Csp3-O podstawników metoksylowych. Obejmują one eliminację rodników 
metylowych, prowadzącą do parzystoelektronowych jonów fragmentacyjnych f, g, 
oraz i, a także nieparzystoelektronowego jonu fragmentacyjnego h. 
Rozpad wiązań w podstawniku fenylowym związku WP jest widziany po raz pierwszy 
w piątym i dalszych krokach fragmentacji. Parzystoelektronowy jon fragmentacyjny k 
a także nieparzystoelektronowe jony fragmentacyjne j oraz l są otrzymane w ten 
sposób.
		

/p0157.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
151 
Schemat rozpadu związku WP (rys. 27) ukazuje charakterystyczne cechy 
rozpadu EI-MS parzystoelektronowych układów tetracyklicznych jonów 
fragmentacyjnych c, d, oraz f. Są to proste rozpady wiązań Csp2-N, Csp2-O i Csp2-CO 
w pierścieniu 1,3-oksazolu (jon d) i pirolidonu (jony c i f), którym towarzyszy migracja 
lub retencja ładunku oraz również migracja wodoru. Przez rozpad dwóch wiązań 
powstają uzupełniające się jony parzystoelektronowe i nieparzystoelektronowe 
zgodnie z poniższymi równaniami odpowiadającym kolejnym krokom fragmentacji: 
c┐+ →o┐+·+m┐+ 
d┐+→ r┐+· + m┐+ 
f┐+ →r┐+·+p┐+ 
f┐+ →n┐+·+s┐+ 
Rozpad fragmentacyjny związku WP wskazuje, że obecność podstawnika 
karboksylowego w pierścieniu fenylowym wraz ze strukturą jonu obojnaczego wpływa 
na stabilność jonu molekularnego w warunkach rozpadu EI. Jon molekularny a jest 
jonem podstawowym na widmie EI-MS. Z drugiej strony tetracykliczna struktura 
parzystoelektronowych jonów fragmentacyjnych [M- 
·H] b, [M·H-CO] d, [M- 
·OH] c jest 
znacznie mniej stabilna niż struktura parzystoeletronowego jonu fragmentacyjnego 
[M- 
·COOH] e. Obecność pierścienia 1,3-oksazolu (jony d oraz f) i pierścienia 
pirolidonu (jon c) w strukturach jonów c, d oraz f wpływa na podatność na zerwanie 
wiązań Csp2-N, Csp2-O i Csp2-CO i tworzenie komplementarnych jonów 
fragmentacyjnych (o+m; r+m; r+p; n+s). 
Optymalizacja otrzymywania nowej pochodnej polegała na przeprowadzeniu 
preparatyki w czterech różnych temperaturach (313 K, 323 K, 333 K oraz 343 K). 
Próbki do oznaczeń pobierano w określonych odstępach czasowych do momentu, w 
którym stwierdzono brak ubytku substratu oraz przyrostu produktu (rys. 52-75, tab. 
21-44). 
Dla związku X wykreślono zależność lnc = f(t), natomiast dla związku WP 
zależność ln(c∞-c) = f(t). C∞ jest to maksymalne stężenie, gdy nie stwierdza się 
przyrostu ilości produktu. Obliczenie logarytmu różnicy (c∞-c) jako funkcji czasu daje 
liniową zależność. 
Na podstawie analizy wykresów stwierdzono, że reakcja przebiega zgodnie z 
kinetyką pierwszego rzędu. Z równań półlogarytmicznych dla każdej z reakcji
		

/p0158.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
152 
wyznaczono stałą szybkości reakcji pierwszego rzędu. Jest ona zależna od 
temperatury, ponieważ, wraz z jej wzrostem rośnie wartość stałej reakcji. Wyniki są 
zestawione w tab. 45. Największy przyrost zanotowano w przypadku reakcji 
prowadzonej w roztworze NaOH. W temperaturze 313 K wynosiła ona (2,50 ± 
0,18)·10-5 s-1. W temperaturze 343 K zanotowano ponad czterokrotny wzrost do 
(10,50 ± 1,57)·10-5 s-1. W przypadku KOH wzrost był trzykrotny od wartości (3,33 ± 
0,50)·10-5 s-1 w temperaturze 313 K, do wartości (10,17 ± 1,48)·10-5 s-1 w 
temperaturze 343 K. Z kolei dla LiOH przyrost wartości stałej szybkości reakcji był 
najmniejszy z (3,00 ± 0,37)·10-5 s-1 do (6,33 ± 0,43)·10-5 s-1 -- ponad dwukrotnie. 
Na podstawie przeprowadzonych pomiarów wykreślono równanie Arrheniusa, 
będące liniową zależnością zlogarytmowanej stałej szybkości reakcji od odwrotności 
temperatury [lnk=f(1/T)]. Dla każdej zasady otrzymano liniową zależność. Wartości 
współczynników kierunkowych równania Arrheniusa otrzymanych na podstawie 
pomiaru ubytku substratu oraz przyrostu produktu dla tej samej zasady nie różnią sie 
znacząco. Współczynniki kierunkowe mają największe wartości dla NaOH a 
najmniejsze dla LiOH (rys. 76-77, tab. 45-46). 
Równanie Arrheniusa umożliwia obliczenie energii aktywacji (Ea) czyli 
najmniejszej ilość energii kinetycznej wymaganej do wprowadzenia cząsteczek w 
stan aktywny, czyli taki w jakim są one zdolne do reakcji. Najwyższą wartość 
uzyskano dla NaOH a najmniejszą dla LiOH (tab. 47). Im większa jest wartość energii 
aktywacji, tym gwałtowniej zmienia się stała szybkości danej reakcji ze zmianą 
temperatury, czyli jest bardziej od niej zależna [51, 118]. W tym przypadku reakcja 
prowadzona z użyciem NaOH jest najbardziej zależna od temperatury. Sprawdzono 
również czy różnice nachylenia krzywych są istotne statystycznie za pomocą testu 
równoległości dwóch krzywych. Dla równań Arrheniusa otrzymanych na podstawie 
logarytmów naturalnych stałych reakcji tworzenia związku WP nie stwierdzono różnic 
istotnych statystycznie. Natomiast dla równań Arrheniusa wykreślonych na podstawie 
stałych logarytmów naturalnych ze stałych szybkości rozkładu chlorku X nachylenia 
dla reakcji prowadzonych w LiOH oraz KOH (tα=1,84) nie różnią się statystycznie. Z 
kolei różnice w nachyleniach dla NaOH i KOH (tα=2,15) oraz NaOH i LiOH (tα=3,99) 
są różne statystycznie -- są większe od wartości tabelarycznej, która wynosi 
tα0,05=2,13. 
Na podstawie danych literaturowych [51, 119] przyjmuje się, że energie 
aktywacji reakcji rozkładu mieszczą się w zakresie 40 kJ/mol-120 kJ/mol. Wyniki
		

/p0159.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
153 
zebrane w tab. 47 niewiele różnią się od tej normy. Najwyższą wartość energii 
aktywacji zanotowano dla tworzenia się związku WP w roztworze NaOH i wynosi ona 
42,30 kJ/mol dla ubytku substratu. Z kolei wartość obliczona dla przyrostu produktu 
wynosi 36,34 kJ/mol. Podobna sytuacja ma miejsce w przypadku zastosowania KOH 
w reakcji. W przypadku ubytku substratu energia aktywacji wynosi 34,51 kJ/mol a dla 
przyrostu produktu wynosi 31,95 kJ/mol. W przypadku LiOH wartości energii 
aktywacji praktycznie się od siebie nie różnią: 24,15 kJ/mol (substrat) i 24,60 kJ/mol 
(produkt). Energia aktywacji jest najmniejsza dla LiOH, co świadczy o tym, że stałe 
szybkości reakcji nie zmieniają się gwałtownie wraz ze wzrostem temperatury [120]. 
Na podstawie danych obliczono również wartości czasu t0,1 (tab. 48). W 
przypadku wszystkich zasad stwierdzono, że czasy te maleją wraz ze wzrostem 
temperatury. W temperaturze 313 K najkrótszy czas t0,1 zanotowano dla KOH a 
najdłuższy dla NaOH. Z kolei podniesienie temperatury o 10 K i o 20 K spowodowało, 
że najkrótszy czas t0,1 zanotowano dla KOH a najdłuższe dla LiOH. W temperaturze 
343 K najkrótszy czas t0,1 zanotowano dla NaOH a najdłuższy dla LiOH. Fakt, że 
reakcja zachodzi najwolniej dla LiOH, świadczyć może o fakcie najmniejszej 
zasadowości litu. Wynika ona z położenia tego metalu w układzie okresowym. Lit 
charakteryzuje się z tych metali największą elektroujemnością, która wynosi 0,98. Dla 
porównania elektroujemność atomu sodu wynosi 0,93 a potasu 0,82 [121]. Sód i 
potas tworzą silniejsze zasady od litu. 
Na podstawie przeprowadzonych badań można stwierdzić, że związek WP 
powstaje najszybciej w temperaturze 343 K przy użyciu NaOH. 
Wyznaczona wartość pH50% przemiany związku X (rys. 78, tab. 50) w związek 
WP wynosi 11,58. Jest to pH, w którym stężenia chlorku X (substrat) i związku WP 
(produkt) są sobie równe. 
Badanie rozpuszczalności objęło wyznaczenie rozpuszczalności substancji w 
temperaturze 25˚C oraz w 37˚C (tab. 52-54, 56 i 58). Rozpuszczalność wyznaczono 
dla heksafluorofosforanu X, chlorku X, jodku X, związku WP oraz chlorku związku 
NF. W temperaturze 25˚C największą rozpuszczalność zaobserwowano dla chlorku 
związku X (4,3343 g/l, tab. 53) natomiast najsłabiej rozpuszczał się 
heksafluorofosforan związku X (0,0713 g/l, tab. 52). Wraz ze wzrostem temperatury 
do 37˚C następuje wzrost rozpuszczalności dla wszystkich badanych substancji (tab. 
52-56). W temperaturze 37˚C największą rozpuszczalnością charakteryzuje się 
chlorek X (4,5762 g/l) natomiast najmniejszą heksafluorofosforan X (0,1075 g/l).
		

/p0160.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
154 
Opierając się na podziale rozpuszczalności według FP VIII można zaklasyfikować 
heksafluorofosforan X w temperaturze 25˚C do związków praktycznie 
nierozpuszczalnych (1 cz. rozpuszcza się w więcej niż w 10000 cz. rozpuszczalnika), 
a w temperaturze 37˚C do substancji bardzo trudno rozpuszczalnych (1cz. 
rozpuszcza się w 1000-10000 cz. rozpuszczalnika). Chlorek X, jodek X i chlorek NF 
w obu temperaturach są związkami trudno rozpuszczalnymi (1cz. rozpuszcza się w 
100-1000 cz. rozpuszczalnika). Związek WP zarówno w temperaturze 25˚C jak i 37˚C 
pozostaje substancją bardzo trudno rozpuszczalną. 
Lipofilowość często uważana jest za najważniejszy parametr fizykochemiczny 
tłumaczący różnice w aktywności biologicznej związków o podobnej budowie 
chemicznej. Boyce i Millborrow zasugerowali użycie współczynnika Rm do 
wyznaczania lipofilowości po to, aby uniknąć trudności, które pojawiały się, gdy 
lipofilowość wyznaczano metodami klasycznymi [122]. Współczynnik Rm jest liniową 
funkcją pracy przeniesienia substancji z fazy stacjonarnej do fazy ruchomej [123]. W 
naszych badaniach wykorzystaliśmy liniową zależność Rm jako funkcji zawartości 
modyfikatora polarności (acetonitrylu). Metodą ekstrapolacji wyznaczona została 
wartość Rmw, czyli taka wartość Rm dla fazy ruchomej, w której znajduje się tylko 
woda. W równaniu liniowym wartość ta odpowiada przecięciu z OY. Wyniki pomiarów 
przedstawione są w tab. 59-60 i na rys. 83-91. Równiania TLC substacji badanych 
charakteryzują się ujemnym współczynnikiem kierunkowym. Ujemna watość 
nachylenia oznacza, że wraz ze wrostem stężenia polarnego modyfikatora wartość 
Rm dla związków lipofilowych maleje szybciej niż dla mniej lipofilowych pochodnych. 
Innymi słowy, związki lipofilowe są bardziej wrażliwe na zmianę polarności fazy 
ruchomej. Ponadto ujemne nachylenie równań TLC świadczy o wzroście migracji na 
jednostkę wzrostu stężenia modyfikatora polarności [122]. Spośród badanych trzech 
związków najmniejszym współczynnikiem kierunkowym charakteryzuje się związek 
WP natomiast wartości współczynników kierunkowych związków X oraz NF są 
większe. Świadczy to o większej lipofilowości tych związków. Korzystając z 
prostoliniowej zależności Rmw = f(logP) wyznaczonej dla substancji wzorcowych (rys. 
92, tab. 61), wyznaczone zostały współczynniki lipofilowości dla badanych związków. 
LogP związku WP wynosi 0,97, chlorku X przyjmuje wartość 3,28, natomiast dla 
chlorku NF ma wartość 3,85. 
Związki X oraz NF charakteryzują się zamkniętą budową pierścieniową, 
natomiast w związku WP otwarcie pierścienia mogło spowodować zmniejszenie
		

/p0161.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
155 
wartości logP. Ponadto wartość nachylenia na rys. 83 dla związku WP, w porównaniu 
ze związkiem X i NF (rys. 84-85) jest najmniejsza, co świadczyć może o najmniejszej 
lipofilowości spośród tych trzech pochodnych. 
Badania cytotoksyczności przeprowadzono in vitro na komórkach raka piersi 
(MCF-7). Miarą toksyczności jest IC50, czyli stężenie, w którym zahamowany jest 
wzrost organizmów o 50% [124]. Wykazały, że najsilniejsze właściwości 
cytotoksyczne ma związek X. Jego IC50 wynosi 0,4142 μM (rys. 94, tab. 63). Z kolei 
związek NF charakteryzuje się stężeniem około trzykrotnie wyższym, które wynosi 
1,2148 μM (rys.93, tab. 62). Natomiast związek WP nie wykazuje aktywności 
cytotoksycznej, ponieważ stężenie IC50 wynosi 14,98 mM (rys. 95, tab. 64). W 
związku z wykazaniem aktywności cytotoksycznej związków X oraz NF, wykonano 
dla nich oznaczenia hamowania aktywności telomerazy (rys. 96-97, tab. 65). Jest to 
enzym zapobiegający skracaniu końców DNA. Zwiększoną aktywność obserwuje się 
w zmianach nowotworowych. Aktywność telomerazy jest bardziej zahamowana w 
bardzo niskich stężeniach związków (0,001 μM-0,1 μM). Obserwuje się większą 
selektywność w stosunku do telomerazy niż do polimerazy Taq. Natomiast w 
wyższych stężeniach (0,1 μM-10 μM) następuje wzrost hamowania polimerazy Taq z 
utratą selektywności w stosunku do telomerazy. 
W badaniach powinowactwa do kwasów nukleinowych badano różne struktury 
DNA - od prostych jednoniciowych poprzez fragmenty o powtórzonej sekwencji 
nukleotydów aż do kwadrupleksów (tab. 67). Wyniki przedstawione są w tabeli 66 i 
na rys. 98. 
Badania powinowactwa do DNA metodą dializy równowagowej pokazały, że 
największym powinowactwem do DNA charakteryzuje się związek X. Badane związki 
praktycznie nie wykazują powinowactwa do do struktur jednoniciowych oraz do 
dupleksów: polydA:polydT oraz polydG:polydC. Związek X w porównaniu z 
pozostałymi dwoma wykazuje większe powinowactwo do poly dA:poly dT. Duże 
powinowactwo związku X można zaobserwować w stosunku do bogatych w guaninę 
kwadrupleksów takich jak primer 4 (promotor c-myc), primer 5 (ludzki telomer) oraz 
primer 6 (cztery równoległe nicie tworzą G-kwadruplex). Są to geny, których 
nadekspresję można zaobserwować w komórkach nowotworowych [125, 126, 127]. 
Największe stężenie związanych związków zanotowano dla tripleksu 
polydA·polydT·polydA.
		

/p0162.djvu

			5. Omówienie i dyskusja wyników 
__________________________________________________________________________ 
156 
Przeprowadzone badania potwierdzają wcześniejsze obserwacje, że 
największą aktywnością cytotoksyczną charakteryzuje się związek X [6, 76]. 
Aktywność cytotoksyczna oraz hamująca telomerazę sprawiają, że substancje te 
mogą być potencjalnymi lekami przeciwnowotworowymi. W przyszłości warto 
otrzymać pochodne związku X. Warto rozważyć wprowadzenie układu rezorcyny. 
Mogłoby to się przyczynić do zwiększenia efektu cytotoksycznego bądź większej 
inhibicji telomerazy [128].
		

/p0163.djvu

			6. Wnioski 
__________________________________________________________________________ 
157 
6. Wnioski 
1. Nowym związkiem powstającym w wyniku alkalicznej oksydacji wodnego 
roztworu chlorku związku X za pomocą roztworu NaOH jest sól wewnętrzna 2- 
(2-karboksy-4,5-dimetoksyfenylo)-6,7-dimetoksyozochinoliniowa, czyli związek 
WP. 
2. Związek WP powstaje na skutek ataku grupy hydroksylowej na pozycję węgla 
C-12 związku X, co skutkuje otwarciem pierścienia pięciowęglowego. 
3. Związek ten najszybciej powstaje w temperaturze 70˚C zgodnie z kinetyką 
pierwszego rzędu w roztworze NaOH o stężeniu 0,1 M. 
4. Najsilniejsze właściwości cytotoksyczne wykazuje jodek związku X. Nowa 
pochodna nie wykazuje ich wcale. 
5. Związek X wykazuje największe powinowactwo do DNA oraz dużą aktywność 
hamującą telomerazę. 
6. Najmniejszym współczynnikiem lipofilowości charakteryzuje się związek WP. 
Związek NF oraz X mają zbliżone współczynniki lipofilowości i są one większe 
od wartości dla WP. Większy współczynnik lipofilowości świadczyć może o 
łatwiejszym przenikaniu przez błony biologiczne, 
7. Powyższe sole izochinoliniowe można zaklasyfikować według FP VIII jako 
związki trudno lub bardzo trudno rozpuszczalne w wodzie. 
8. Należy prowadzić dalsze badania nad pochodnymi związku X w celu 
zmniejszenia wartości jego IC50.
		

/p0164.djvu

			7. Streszczenie 
__________________________________________________________________________ 
158 
7. Streszczenie 
Głównym celem rozprawy doktorskiej było rozwiązanie struktury nowej 
pochodnej (związek WP) powstałej w wyniku alkalicznej oksydacji brunatnego 
związku X. 
Związek WP powstaje z wydajnością około 10%. Izolacji dokonano metodą 
klasycznej chromatografii cieczowej. Identyfikację jego struktury dokonano za 
pomocą metod klasycznych (analiza elementarna) oraz za pomocą nowoczesnych 
metod spektroskopowych takich jak badania spektroskopowe w zakresie nadfioletu i 
podczerwieni, spektroskopia mas, spektroskopia NMR. W tej ostatniej obok prostych 
widm jednowymiarowych (1H, 13C, 15N) wykorzystano również widma dwuwymiarowe 
(HMBC, HSQC, COSYLR oraz NOESY). W wyniku analizy udało się zidentyfikować 
nowy związek jako sól wewnętrzną 2-(2-karboksy-4,5-dimetoksyfenylo)-6,7- 
dimetoksyozochinoliniową. 
Przeprowadzone badania kinetyczne dowiodły, że najkorzystniejszymi 
warunkami do otrzymywania związku WP jest temperatura 70˚C przy użyciu NaOH o 
stężeniu 0,1 M. Proces tworzenia nowego związku zachodzi zgodnie z kinetyką 
pierwszego rzędu. 
Obok struktury, wyznaczono również rozpuszczalność pochodnych 
izochinoliniowych. Wg FP VIII zaklasyfikować je można jako substancje trudno 
rozpuszczalne w temperaturze pokojowej w wodzie. Wzrost temperatury do 37˚C 
powoduje wzrost rozpuszczalności. 
Korzystając z metody chromatografii cienkowarstwowej (TLC) wyznaczono 
również współczynniki lipofilowości (logP). Najmniejszą lipofilowością charakteryzuje 
się związek WP. Związek X oraz NF posiadają współczynniki lipofilowości o 
zbliżonych wartościach. Większa lipofilowość umożliwia przenikanie związku przez 
błony biologiczne. 
Przeprowadzone badania cytotoksyczności dowiodły, że najbardziej toksyczny 
jest związek X, natomiast związek WP nie wykazuje aktywności cytotoksycznej. 
Spośród tych trzech pochodnych izochinoliniowych największe powinowactwo do 
kwasów nukleinowych również wykazuje związek X. Najsilniej również hamuje 
telomerazę.
		

/p0165.djvu

			8. Summary 
__________________________________________________________________________ 
159 
8. Summary 
'Preparation, structure and chosen physical, chemical and 
biological activities of a new papaverine derivative' 
The structure elucidation of the new unknown isoquinoline derivative 
(compound WP) was the main aim of the project. The alkalization of the aqueous 
solution of brown compound X leads to a new molecule with a yield approximately 
10%. 
The compound WP was isolated by means of column liquid chromatography. 
Its structure was elucidated by classical method (elemental analysis) and 
spectroscopic methods such as UV/IR spectroscopy, mass spectrometry and NMR 
spectroscopy. Not only one-dimensional NMR spectra (i.e. 1H, 13C, 15N) but also the 
advanced two-dimensional techniques (i.e. HMBC, HSQC, COSYLR and NOESY) 
were applied. The new entity was identified with 2-(2-carboxy-4,5-dimethoxyphenyl)- 
6,7-dimethoxyisoquinolinium inner salt. 
It was found that the most convenient conditions for the compound WP 
preparation were the temperature 70˚C in 0,1 M NaOH aqueous solution. The 
reaction follows the first order kinetics. 
The solubility in water of the isoquinolinium salts was determined. According to 
the Polish Pharmacopeia VIII at the room temperature they can be classified as 
sparingly soluble. An increase of temperature to 37˚C results in elevation of their 
solubility. 
The lipophilicity of the new compounds was determined by thin layer 
chromatography (TLC). Compound WP is the least lipophilic compound (logP=0,97). 
The levels of compound X (2,3,9,10-tetramethoxy-12-oxo-12-H-indolo[2,1- 
a]isoquinolinium chloride) and NF (13-(3,4-dimethoxyphenyl)-2,3,8,9-tetramethoxy- 
6a-12a-diazadibenzo[a,g]fluorenylium chloride) lipophilicity are approximately the 
same (logP= 3,28 and 3,85 respectively). 
The most cytotoxic is compound X (IC50=0,4125μM). The compound WP does 
not possess any cytotoxic activity. Among the three compounds studied the highest 
DNA binding affinity is observed for compound X. The above compound inhibits also 
telomerase activity to a highest extent.
		

/p0166.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
160 
9. Piśmiennictwo 
1. Rácz I., Varsányi D.: Spektrophotometrische Mikrobestimmung der 
Zersetzungsprodukte des Papaverins. Pharm. Ztrhalle., 1962, 101, 18-25. 
2. Machovičová F., Parrák V.: Die papierchromatographische Trennung von 
Papaverin, Papaverinol und Papaveraldin. Pharmazie. 1959, 14, 10-12. 
3. Hermann T., Lisowski Z., Wroński A.: Badania nad trwałością roztworów 
iniekcyjnych chlorowodorku papaweryny. Biul. Wojsk. Akad. Med. (Łódź), 
1965, 8, 235-241. 
4. Girreser U., Hermann T., Piotrowska K.: Oxidation and degradation products 
of papaverine. Part 2[1]: Investigations on the photochemical degradation of 
papaverine solutions. Arch. Pharm. Pharm. Med. Chem., 2003, 336, 401-405. 
5. Piotrowska K., Hermann T.W., Augustyniak W.: Photooxidation of papaverine, 
papaverinol and papaveraldine in their chloroform solutions. Acta Pol. Pharm., 
2002, 59, 359-364. 
6. Mądry L., Gałęzowska E., et al.: Interactions of the oxidation products of 
papaverine with guanine quadruplexes. Pol. J. Chem., 2006, 80, 921-929. 
7. Hermann T., Piotrowska K.: Dwa nowe barwniki- produkty utlenienia i (lub) 
fotoutlenienia papaweryny i ich aktywność biologiczna. W: Osiągnięcia w 
chemii leków. Jelińska A., Marciniec B. (red.), Wydawnictwo Kontekst, Poznań 
2007. 
8. Piotrowska K., Hermann T., Augustyniak W.: Kinetics of photooxidation of 
papaverine hydrochloride and its major photooxidation products. J. Pharm. 
Biomed. Anal., 2006, 41, 1391-1395. 
9. Bondari S. (editor): The Merck Index. An encyclopedia of chemical, drugs and 
biologicals. 12th edition, Whitehouse Station NJ, 1996. 
10. Kostowski W., Hermann Z.: Farmakologia. Podstawy farmakoterapii. WL 
PZWL, Warszawa 2007. 
11. Romics I., Molnar D. L., Timberg G., Jelakovich B., et al.: The effect of 
drotaverine hydrochloride in acute colicky pain caused by renal and ureteric 
stones. Brit. J. Urol., 2003, 92, 92-96. 
12. Gorczyca M., Zejc A.: Chemia leków. WL PZWL, Warszawa 2002. 
13. Zając M., Pawełczyk E.: Chemia leków dla studentów farmacji i farmaceutów, 
AMiKM, Poznań 2002.
		

/p0167.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
161 
14. Perk G, Hanna S., et al.: Lethal oral papaverine overdose. Am. J. Emerg. 
Med., 2003, 21, 245. 
15. Sivrikaya A., Celik O., et al: The effect of diclofenac sodium and papaverine on 
isolated human ureteic smooth muscle. Int. J. Urol. Neph., 2003, 35, 479-483. 
16. Boswell-Smith V., Spina D., et al.: Phospodiesterase inhibitors. Br. J. 
Pharmacol., 2006, 147, S252-S257. 
17. Snir N., Moskovitz B., et al: Papaverine hydrochloride for the treatment of 
renal colic - an old drug revisited. A prospective randomized study, J. Urology. 
2008, 179, 1411-1414. 
18. Hebb A., Robertson H., et al.: Phosphodiesterase 10A inhibition is associated 
with locomotor and cognitive deficits and increase anxiety in mice. Eur. 
Neurpsychopharmacol., 2008, 18, 339-363. 
19. Schmidt C., Chapin D., et al: Preclinical characterisation of selective 
phosphodiesterase 10A inhibitors: A new therapeutic approach to the 
treatment of schizophrenia. J. Pharmacol. Exp. Ther., 2008, 325, 681-690. 
20. Formica F., Ferro O., et al.: Effects of papaverine and glycerilnitrate-verapamil 
solution as topical and intraluminal vasodilators for internal thoracic artery. 
Ann. Thorac. Surgery. 2006, 81, 120-124. 
21. Carhuapoma J., Qureshi A., et al.: Intra-arterial papaverine --induced 
seizures; case report and review of the literature. Surg. Neurol., 2001, 55, 159- 
163. 
22. Vilandt J., Kjargard H., et al.: Intraluminal papaverine with pH 3 doubles blood 
flow in the internal mammary artery. Scand. Cardiovasc. J., 1999, 33, 330- 
332. 
23. Duckwiler G.: Balloon angioplasty and intra-arterial papaverine for vasospasm. 
J. Stroke Cerebrovasc., 1997, 6, 261-263 
24. Dalbasti T., Karabiyikoglu M., et al.: Efficacy of controlled-release papaverine 
pellets in preventing symptomatic cerebral vasospasm. J. Neurosurg., 2001, 
95, 44-50. 
25. Koramaz I., Ozkan M., et al.: Effects of papaverine and carbon dioxide alone 
or in combination on the blood flow of internal thoracic artery. J. Thorac. 
Cardiov. Sur., 2006, 132, 1126-1130.
		

/p0168.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
162 
26. Morgan M., Halcrow S., et al.: Outcome of aneurismal subarachnoid 
haemorrhage following the introduction of papaverine angioplasty. J. Clin. 
Neurosci., 1996, 3, 139-142. 
27. Milburn J., Moran Ch. J., et al.: Effect of intraarterial papaverine on cerebral 
circulation time. Am. J. Neuroradiol., 1997, 18, 1081-1085. 
28. Smith W. S., Dowd Ch. F., et al.: Neurotoxicity of intra-arterial papaverine 
preserved with chlorobutanol used for the treatment of cerebral vasospasm 
after aneurismal subarachnoid hemorrhage. Stroke. 2004, 35, 2518-2522. 
29. Fujiwara N., Honjo Y., et al.: Intraarterial infusion of papaveine in experimental 
cerebral vasospasm. Am J Neuroradiol., 1997, 18, 255-262. 
30. Hon-Man Liu, Young-Kwang Tu: The efficacy of papaverine administration by 
different routes for the treatment of experimental acute cerebral vasospasm. J. 
Clin. Neurosci., 2002, 9, 561-565. 
31. Vajkoczy P., Horn P., et al.: Effect of intra-arterial papaverine on regional 
cerebral blood flow in hemodynamically relevant cerebral vasospasm. Stroke. 
2001, 32, 498-505. 
32. Clouston J. E., Numaguchi Y., et al.: Intraarterial papaverine infusion for 
cerebral vasospasm after subarachnoid hemorrhage. Am. J. Neuroradiol., 
1995, 16, 27-38. 
33. Griffin P., Siadaty M.: Papaverine prolongs patency of peripheral artherial 
catheters in neonates. J. Pediatr., 2005, 146, 62-65. 
34. Pedersen G., Laxdal E., et al.: Flow measurement and after papaverine 
injection in above-knee prosthetic femoropopliteal bypass. J. Vasc. Surg., 
2006, 43, 729-734. 
35. Secil M., Arslan D., et al.: The prediction of papaverine induced priapism by 
color doppler sonography. J. Urology. 2001, 165, 416-418. 
36. Pawlicki B.: Leczenie zaburzeń erekcji iniekcjami do ciał jamistych. 
Seksuologia Pol., 2003, 1, 31-34. 
37. Başar M., Batislam E., et al.: Sildafenil citrate for penile hemodynamic 
determination: an alternative to intracervenosal agents in doppler ultrasound 
evaluation of erectile dysfunction. Urology. 2001, 57, 623-626. 
38. Ardicoglu A., Kocakoc E.,et al.: Effectiveness of vardenafil versus papaverine 
in penile doppler ultrasonography. Urol. Int., 2005, 75, 75-79.
		

/p0169.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
163 
39. Ozluoglu L. N., Yilmaz I., et al.: Buffered papaverine facilitates passage of 
intratympanic dexamathasone to the inner ear. Acta Oto-Laryngol., 2006, 126, 
1260-1265. 
40. Gao Y.J., Stead S., et al.: Papaverine induces apoptosis in vascular 
endothelial and smooth muscle cells. Life Sci., 2002, 70, 2675-2685. 
41. Mäyränpää M., Simpanen J., et al.: Arterial enothelial denundation by 
intraluminal use of papaverine-NaCl solution in coronary by-pass surgery. Eur. 
J. Cardiothorac. Surg., 2004, 25, 560-566. 
42. Vaziri N., Stokes J., et al.: Lactic acidosis, a complication of papaverine 
overdose. Clin. Toxicol., 1981, 18, 417-423. 
43. Elliot J., Newell D., et al..: Comparison of baloon angioplaty and papaverine 
infusion for the traetment of vasospasm following aneurysmal subarachnoid 
hemorrhage. J. Neurosurg., 1998, 88, 277-284. 
44. Pawełczyk E., Hermann T.: Charakterystyka chemiczna produktów rozkładu 
leków. I. Badania polarograficzne nad produktami rozkładu chlorowodorku 
papaweryny. Chem. Anal., 1968, 13, 617-625. 
45. Pfeifer S., Behnsen G., et al.: Zersetzungsprodukte von Papaverin. 
Pharmazie. 1972, 27, 342-343. 
46. Pfeifer S., Behnsen G., et al.: Stabilität von Alkaloiden in organischen 
Lösungsmitteln. Teil 1. Pharmazie. 1972, 27, 639-647. 
47. Pfeifer S., Behnsen G., et al.: Stabilität von Alkaloiden in organischen 
Losungsmitteln. Teil 3. Pharmazie. 1972, 27, 734-738. 
48. Sternitz F.R., Seiber R.P., et al.: Imino photoalkylations. Papaverine, 
phenantridine and general mechanism. J. Org. Chem., 1968, 33, 1136-1140. 
49. Dunkel R., Wu X., Identification of organic molecules from a structure 
database using proton and carbon NMR analysis results. J. Magn. Reson., 
2007, 188, 97-110. 
50. Metody spektroskopowe i ich zastosowanie do identyfikacji związków 
organicznych. Zieliński W., Rajca A. (red.), WNT, Warszawa 2000. 
51. Farmacja fizyczna. Podręcznik dla studentów farmacji i analityki medycznej, 
Hermann T. (red.), WL PZWL, Warszawa 1999. 
52. Szczepaniak W.: Metody instrumentalne w analizie chemicznej. PWN, 
Warszawa 2004.
		

/p0170.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
164 
53. Silverstein R. M., Weber F. X., Kiemle D. J.: Spektroskopowe metody 
identyfikacji związków organicznych. PWN, Warszawa 2007. 
54. Gao J., Kamnaing P., et al.: One-step purification of palmatine and its 
derivative dl-tetrahydropalmatine from Enantia chlorantha using high- 
performance displacement chromatography. J. Chromatogr. A., 2008, 1208, 
47-53. 
55. Akitt J.W., Mann B.E.: NMR and chemistry. An introduction to modern 
spectroscopy. Stanley Thornes, Cheltenham 2000. 
56. Zhang Q., Tu G., et al.: Novel bioactive isoquinoline alkaloids from Carduus 
crispus. Tetrahedron. 2002, 58, 6795-6798. 
57. Yang L., Glover R., et al.: Ancisheynine, a novel naphthylisoquinolinium 
alkaloid from Ancistrocladus heyneanus. Tetrahedron Lett., 2003, 44, 5827- 
5829. 
58. Toušek J., Dostál J., et al.: Theoretical and experimental NMR chemical shifts 
of norsanguinarine and norchelerythrine. J. Mol. Struct., 2004, 689,115-120. 
59. Meyer A., Imming P.: R(-)-Canadaline as first secoberbine alkaloid from 
Corydalis cava. Phytochem.Lett., 2008, 1, 168-170. 
60. Kinoshita K., Yamamoto Y., et al.: Novel fluorescent isoquinoline pigments, 
panaefluorolines A--C from the cultured mycobiont of a lichen. Amygdalaria 
panaeola. Tetrahedron Lett., 2003, 44, 8009-8011. 
61. Girreser U., Czyrski A., et al: Synthesis and structure elucidation of a new 
isoquinolinium inner salt. Tetrahedron Lett., 2009, 50, 4610-4612. 
62. Wong T., Collazo L., et al.: 14N and 15N NMR studies of highly sterically 
hindered tertiary amines. Tetrahedron. 1995, 51, 649-656. 
63. Kamieński B., Schilf W., et al.: The 15N and 13C solid state NMR study of 
intramolecular hydrogen bond in some Schiff's bases. Solid State Nucl. Mag., 
2000, 16, 285-289. 
64. Lyčka A., Frebort Š., et al.: A 15N NMR study of tautomerism in dimethyl 
dihydro-1,2,4,5-tetrazine-3,6-dicarboxylate. Tetrahedron Lett., 2008, 49, 4213- 
4215. 
65. Trigalo F., Martin M., et al.: Oxidation of indolines to nitrones and new 
rearrangement in seco-curane type indoline alkaloids. Tetrahedron. 2002, 58, 
4555-4558.
		

/p0171.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
165 
66. Marek R., Humpa O., et al.: 15N NMR study of isoquinoline alkaloids. Magn. 
Reson. Chem., 1999, 37, 195-202. 
67. Płaziak A.; Spektrometria masowa związków organicznych. Wydawnictwo 
UAM, Poznań 1996. 
68. Iwasa K., Won Kim C.: Biotransformations of protoberberines in cell cultures of 
Dicentra spectablis. Phytochemistry. 1997, 46, 1359-1363. 
69. Geen G., Mann I., et al.: A versatile synthesis of fully aromatic 
benzo[c]phenanthridine alkaloids. Tetrahedron. 1998, 54, 9875-9894. 
70. Cordonnier M., Hildebrand M., et al.: Design, synthesis and biological 
evaluation of new oligopyrrole carboxamides linked with tricyclic DNA- 
intercalators as potential DNA ligands or topoisomerase inhibitors. Eur. J. 
Med. Chem., 2007, 42, 752-771. 
71. Hayashida H, Paczesny J., et al.: Interactions of sodium and potassium ions 
with oligonucleotides carrying human telomeric sequence and pyrene moieties 
at both termini. Bioorgan. Med. Chem., 2008, 16, 9871-9881. 
72. www.baltic-analytics.de/uploads/pics/mtt-test.gif, data wejścia:28.09.2009 r. 
73. Ulukaya E., Ozdikicioglu F., et al..: The MTT assay yields a relatively lower 
result of growth inhibition than the ATP assay depending on the 
chemotherapeutic drugs tested. Toxicol. in vitro. 2008, 22, 232-239. 
74. Juskowiak B., Gałęzowska E.,et al.: Aggregation and G-quadruplex DNA- 
binding study of 6a,12a-diazadibenzo-[a,g]fluorenylium derivative. Bioorg. 
Med. Chem. Lett., 2004, 14, 3627-3630. 
75. Ren J., Chaires J.: Sequence and structural selectivity of nucleic acid binding 
ligands. Biochemistry-US. 1999, 38, 16067-16075. 
76. Gałęzowska E., Masternak A., Rubiś B., et al.: Spectroscopic study and G- 
quadruplex DNA binding affinity of two bioactive papaverine-derived ligands. 
Int. J. Biol. Macromol., 2007, 41, 558-563. 
77. Bhadra K., Maiti M., et al.: Berberine--DNA complexation: New insights into the 
cooperative binding and energetic aspects. BBA-Gen. Subjects. 2008, 1780, 
1054-1061. 
78. Ma Y., Ou T., et al.: 9-N-Substituted berberine derivatives: Stabilization of G- 
quadruplex DNA and down-regulation of oncogene c-myc, Bioorgan. Med. 
Chem., 2008, 16, 7582-7591.
		

/p0172.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
166 
79. Jóźwiak K., Szumiło H., et al.: Lipofilowość, metody oznaczania i rola w 
działaniu biologicznym substancji chemicznych. Wiad. Chem., 2000, 55, 1047- 
1075. 
80. Kępczyńska E., Bojarski J., et al.: Retention of barbituric acid derivatives in 
immobilized artificial membrane stationary phase and its correlation with 
biological activity. Biomed. Chromatogr., 2000, 14, 256-260. 
81. Kępczyńska E., Bojarski J., et al.: Lipophilicity of barbiturates determined by 
TLC. J. Chromatogr. R. T., 2003, 26, 3277-3287. 
82. Kępczyńska E., Obłoza E., et al: Lipophilicity of thiobarbiturates determined by 
TLC. Acta Pol. Pharm., 2007, 64, 295-302. 
83. Kaliszan R.; Effect of separation conditions on chromatographic determination 
of hydrophobicity of acidic xenobiotics. J. Chromatogr. B. 1998, 717, 125-134. 
84. Braumann T.: Detrmination of hydrophobic parameters by reversed-phase 
liquid chromatography: theory experimantal techniques and application in 
studies on quatitative structure-activity relationship. J. Chromatogr., 1986, 373, 
191-225. 
85. Lipinski C., Lombardo F., et al.: Experimental and computational approaches 
to estimate solubility and permeability in drug discovery and development 
settings. Adv. Drug Deliver. Rev., 1997, 23, 3-25. 
86. Waterhouse R.: Determination of lipophilicity and its use as a predictor of 
blood-brain barrier penetration of molecular imaging agents. Mol. Imaging 
Biol., 2003, 5, 376-389. 
87. Leopoldo M., Lacivita E., et al.: Design, synthesis and binding affinities of 
potential positron emission tomography (PET) ligands with optimal lipophilicity 
for brain imaging of the dopamine D3 receptor. Part II. Bioorgan. Med. Chem., 
2009, 17, 758-766. 
88. Gulyaeva N., Zaslavsky A., et al..: Relative hydrophobicity and lipophilicity of 
drugs measured by aqueous two-phase partitioning, octanol-buffer partitioning 
and HPLC. A simple model for predicting blood-brain distribution. Eur. J. Med. 
Chem., 2003, 38, 391-396. 
89. Djaković-Sekulić T., Ačanski M.,et al.: Evaluation of the predictive power of 
calculation procedure for molecular hydrophobicity of some estradiol 
derivatives. J. Chromatogr. B. 2001, 766, 67-75.
		

/p0173.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
167 
90. Hermann T., Girreser U., et al.: Oxidation and degradation products of 
papaverine. Pt. 1: Gadamer and Schulemann's papaverinol synthesis 
revisited. Arch. Pharm. Pharm. Med. Chem., 2002, 335, 167-169. 
91. Hermann T.: Kinetics and mechanism of degradation of some 5-allybarbituric 
acid derivatives. Pharmazie 1976, 31, 618-623. 
92. Hansch C., Leo A., et al: Exploring QSAR Hydrophobic, Electronic and Steric 
Constants. ACS Professional Reference Book, ACS, Washington 1995. 
93. Pawełczyk E., Hermann T.: Charakterystyka chemiczna produktów rozkładu 
papaweryny. Część I. Metoda oceny stopnia rozkładu chlorowodorku 
papaweryny. Dissert. Pharm., 1965, 18, 569-575. 
94. Kochkar H., Morawietz M., et al.: Oxidation of potato starch with NO2: 
characterization of the carboxylic acid salts. Appl. Catal. A-Gen., 2001, 210, 
325-328. 
95. Zeleňák V., Vargová Z., et al: Correlation of infrared spectra of zinc(II) 
carboxylates with their structures. Spectrochim. Acta A. 2007, 66, 262-27. 
96. Marechal Y.: The hydrogen bond and the water molecule. The physics and 
chemistry of water gaseous and bio-media. Elsevier Amsterdam Boston 2007. 
97. Valor A., Reguera E. et al.: Thermal decomposition of the calcium salts of 
several carboxylic acids. Thermochim. Acta. 2002, 389, 133-139. 
98.Gao J-M., Liu W-T., et al: Preparation and structural elucidation of (-)- 
tetrahydroberberine-(+)-2,3-di(p-toluyl) tartaric acid complex. J. Mol. Struct., 
2008, 892, 466-469. 
99. Grycová L., Dostál J.: Quaternary protoberberine alkaloids. Phytochemistry. 
2007, 68, 150-175. 
100. Blaskó G., Cordell G.: Carbon-13 NMR assignments of berberine and 
sanguinarine. Heterocycles. 1988, 27, 911-916. 
101. Wafo P., Nyasse B., et al.: a 7,8-dihydropalmatine from Enanthia 
chlorantha. Phytochemistry. 1999, 50, 279-281. 
102. Suau R., Silva M., et al.: A novel oxidation stage in the chemistry of 
protoberberine alkaloids f. Sythesis of 7,8-dehydroberberines. Tetrahedron. 
1991, 30, 5841-5846. 
103. Patra A., Montgomery C.T., et al.: The protoberberine alkaloids of 
Stephania suberosa. Phytochemistry. 1987, 26, 547-549.
		

/p0174.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
168 
104. Hsieh T.J., Chia Y.C., et al.: Chemical constituents from the stems of 
Madonia japonica. J. Chin. Chem Soc., 2004, 51, 443-446. 
105. Rasoanaivo P., Ratsimamanga-Uverg S., et al: Constituants chimiques 
de trois especes de Burasaia (Mensispermacees) endemiques de 
Madagascar. Biochem. Syst. Ecol., 1991, 65, 221-244. 
106. Miyazawa M., Yoshio K., et al.: Insecticidal alkaloids from Corydalis 
bulbosa against Drosophilla melanogaster. J. Agric. Food Chem., 1998, 46, 
1914-1919. 
107. Chudik S., Marek R., et al.: Revision of the structure of escholidine. J. 
Nat. Prod., 2006, 69, 954-956. 
108. Kim J.P., Jung M.Y., et al.: Antiphotooxidative activity of 
protoberberines derived from Coptis japonica Makino in the chlorophyll- 
sensitized photooxidation of oil. J. Agric. Food Chem., 2000, 48, 1058-1063. 
109. Segraves N., Lopez S., et al.: Structures and cytotoxicities of 
fascaplysin and related alkaloids from two marine phyla- Fascalysinopsis 
sponges and Didemnum tunicates. Tetrahedron Lett., 2003, 44, 3471-3475. 
110. Barczyński P., Katrusiak A., et al.: Structure of 1- 
carboxymethylpyridinium-4-carboxylate inner salt studied by X-ray diffraction, 
DFT calculations, vibrational and NMR spectra. J. Mol. Struct., 2009, 933, 20- 
29. 
111. Suau R., Silva M.V., et al.: Quaternary protoberberine alkaloids from 
Ceratocapnos heterocarpa. Phytochemistry. 1993, 34, 559-561. 
112. Chia Y.C., Chang F.E., et al.: Protoberberine alkaloids from Fissistigma 
balansae. Phytochemistry. 1998, 48, 367-369. 
113. Czyrski A., Hermann T., et al: Nowy związek sól wewnętrzna 2-(2- 
karboksy-4,5-dimetoksyfenylo)-6,7dimetoksyizochinoliniowa oraz sposób jej 
otrzymywania. Zastrzeżenie patentowe P 387214. Urząd Patentowy 
Rzeczpospolitej Polskiej, Warszawa 2009. 
114. Katritzky, A.; Krutošiková, A., et al.: Studies on some 2,4,6- 
triphenylpiridinum beatines and related species. J. Coll. Czech. Commun., 
1978, 43, 2046-2053. 
115. Walterová, D.; Preininger, V., et al.: Isolation and chemistry of alkaloids 
from some plants of genus Papaver. Pseudobase formation in 2-
		

/p0175.djvu

			9. Piśmiennictwo 
__________________________________________________________________________ 
169 
methylpapaverinum cations and their biostransformation by enzyme of rat liver 
homogenates in vitro. Coll. Czech. Commun., 1980, 45, 956-873. 
116. Fretz H.; Ucci-Stoll K., et al.: Investigations on the reactivity of 
fascaplysin Part II. General stability considerations and products formed with 
nucleophiles. Helv. Chim. Acta. 2001, 84, 867-873. 
117. Wrzeciono U., Krzysztofik B., et al: Ćwiczenia z chemii organicznej. 
Część I Preparatyka organiczna. Wydawnictwa Uczelniane Akademii 
Medycznej, Poznań, 1978. 
118. Atkins P., de Paula J.: Physical Chemistry. Oxford University Press, 
New York 2006, 807 -- 809. 
119. Pawełczyk E., Hermann T.: Podstawy trwałości leków. PZWL, 
Warszawa 1982, 35-51. 
120. Atkins P.: Przewodnik po chemii fizycznej. PWN, Warszawa 1997. 
121. Emsley J.: Przewodnik po pierwiastkach. PWN, Warszawa 1997. 
122. Biagi G.L., Barbaro A.M., et al.: Basic aspects and relationship between 
slope and intercept of TLC equations. J. Chromatogr. A. 1994, 662, 341-361. 
123. Borkowski B.: Chromatografia cienkowarstwowa w analizie 
farmaceutycznej. PZWL, Warszawa 1973. 
124. Nascarella M., Calabresse E.: The relationship between the IC50, toxic 
threshold, and the magnitude of stimulatory response in biphasic (hormetic) 
dose--responses. Regul. Toxicol. Pharm., 2009, 54, 229-233. 
125. Ragazzon P., Garbett N., et al.: Competition dialysis: a method for the 
study of structural selective nucleic acid binding. Methods. 2007, 42, 173-182. 
126. Ragazzon P., Chaires J.: Use of competition dialysis in the discovery G- 
quadruplex selective ligands. Methods. 2007, 43, 313-323. 
127. Czerwińska I., Juskowiak B.: Preferetial binding of arylstilbazolium 
ligands to guanine complexes. Polish J. Chem., 2009, 83, 1227-1230. 
128. Zhao L., Wang X., et al.: Neferine, a bisbenzylisoquinoline alkoloid 
attenuates bleomycin-induced pulmonary fibrosis. Eur. J. Pharmacol., 2010, 
627, 304-312.